ID: 1046952779

View in Genome Browser
Species Human (GRCh38)
Location 8:120033949-120033971
Sequence CTTCAGCCCCCGGTGGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 24230
Summary {0: 1, 1: 0, 2: 16, 3: 811, 4: 23402}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046952779_1046952785 3 Left 1046952779 8:120033949-120033971 CCCAGCTCCACCGGGGGCTGAAG 0: 1
1: 0
2: 16
3: 811
4: 23402
Right 1046952785 8:120033975-120033997 GAGACTTGTTTGAACTCAGGAGG No data
1046952779_1046952784 0 Left 1046952779 8:120033949-120033971 CCCAGCTCCACCGGGGGCTGAAG 0: 1
1: 0
2: 16
3: 811
4: 23402
Right 1046952784 8:120033972-120033994 CAGGAGACTTGTTTGAACTCAGG No data
1046952779_1046952787 9 Left 1046952779 8:120033949-120033971 CCCAGCTCCACCGGGGGCTGAAG 0: 1
1: 0
2: 16
3: 811
4: 23402
Right 1046952787 8:120033981-120034003 TGTTTGAACTCAGGAGGTGGAGG 0: 28
1: 721
2: 9153
3: 33569
4: 81717
1046952779_1046952786 6 Left 1046952779 8:120033949-120033971 CCCAGCTCCACCGGGGGCTGAAG 0: 1
1: 0
2: 16
3: 811
4: 23402
Right 1046952786 8:120033978-120034000 ACTTGTTTGAACTCAGGAGGTGG No data
1046952779_1046952788 25 Left 1046952779 8:120033949-120033971 CCCAGCTCCACCGGGGGCTGAAG 0: 1
1: 0
2: 16
3: 811
4: 23402
Right 1046952788 8:120033997-120034019 GTGGAGGCTGCAGTGAGCCGAGG 0: 50
1: 848
2: 3456
3: 6135
4: 7222

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046952779 Original CRISPR CTTCAGCCCCCGGTGGAGCT GGG (reversed) Intronic
Too many off-targets to display for this crispr