ID: 1046953187

View in Genome Browser
Species Human (GRCh38)
Location 8:120037646-120037668
Sequence ATGTCACTCTAGCAGAAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046953184_1046953187 15 Left 1046953184 8:120037608-120037630 CCAGGAGACACTAATCTTCACCT 0: 1
1: 0
2: 1
3: 6
4: 130
Right 1046953187 8:120037646-120037668 ATGTCACTCTAGCAGAAGAATGG No data
1046953185_1046953187 -5 Left 1046953185 8:120037628-120037650 CCTTATTATTACGTCCTAATGTC 0: 1
1: 0
2: 0
3: 1
4: 80
Right 1046953187 8:120037646-120037668 ATGTCACTCTAGCAGAAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046953187 Original CRISPR ATGTCACTCTAGCAGAAGAA TGG Intronic
No off target data available for this crispr