ID: 1046958653

View in Genome Browser
Species Human (GRCh38)
Location 8:120086905-120086927
Sequence GGTTAGGCTGACTCCACTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046958644_1046958653 22 Left 1046958644 8:120086860-120086882 CCCGTCCCCAGGTCTCATTGCTT 0: 1
1: 0
2: 0
3: 32
4: 232
Right 1046958653 8:120086905-120086927 GGTTAGGCTGACTCCACTGTAGG No data
1046958647_1046958653 16 Left 1046958647 8:120086866-120086888 CCCAGGTCTCATTGCTTCTCTCA 0: 1
1: 0
2: 1
3: 20
4: 281
Right 1046958653 8:120086905-120086927 GGTTAGGCTGACTCCACTGTAGG No data
1046958648_1046958653 15 Left 1046958648 8:120086867-120086889 CCAGGTCTCATTGCTTCTCTCAT 0: 1
1: 0
2: 2
3: 29
4: 270
Right 1046958653 8:120086905-120086927 GGTTAGGCTGACTCCACTGTAGG No data
1046958645_1046958653 21 Left 1046958645 8:120086861-120086883 CCGTCCCCAGGTCTCATTGCTTC 0: 1
1: 0
2: 2
3: 33
4: 368
Right 1046958653 8:120086905-120086927 GGTTAGGCTGACTCCACTGTAGG No data
1046958643_1046958653 23 Left 1046958643 8:120086859-120086881 CCCCGTCCCCAGGTCTCATTGCT 0: 1
1: 0
2: 0
3: 13
4: 174
Right 1046958653 8:120086905-120086927 GGTTAGGCTGACTCCACTGTAGG No data
1046958646_1046958653 17 Left 1046958646 8:120086865-120086887 CCCCAGGTCTCATTGCTTCTCTC 0: 1
1: 0
2: 3
3: 27
4: 393
Right 1046958653 8:120086905-120086927 GGTTAGGCTGACTCCACTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046958653 Original CRISPR GGTTAGGCTGACTCCACTGT AGG Intronic
No off target data available for this crispr