ID: 1046963075

View in Genome Browser
Species Human (GRCh38)
Location 8:120130336-120130358
Sequence ATGACCTATCTGGCCAAATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 105}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046963075 Original CRISPR ATGACCTATCTGGCCAAATG TGG (reversed) Intronic
900655436 1:3754575-3754597 ATGAGCTATCTGGCTTTATGGGG - Intronic
901728056 1:11257817-11257839 ATGACCTGCCTGGCCAGTTGTGG + Intronic
902254368 1:15178114-15178136 TTGACCCATCAGGCCACATGAGG + Intronic
904658734 1:32069012-32069034 GTGACCTGTCAGCCCAAATGAGG - Intergenic
910872559 1:91848245-91848267 ATGACCTATGCTGTCAAATGTGG + Intronic
911663776 1:100532119-100532141 AGGACCTAGCTGGGCAAAAGTGG + Intergenic
915677839 1:157548104-157548126 ATGTCCTGCCTGGCTAAATGGGG + Intronic
915686985 1:157643659-157643681 ATGTCCTGCCTGGCTAAATGGGG + Intergenic
915882345 1:159685259-159685281 AGGAGTTAGCTGGCCAAATGAGG - Intergenic
920801157 1:209188759-209188781 ATGACCTTTCTGACCAAAATGGG - Intergenic
1065026771 10:21546367-21546389 ATGTCCTCTCTGGCCAGATACGG - Intronic
1069483508 10:68805483-68805505 ATGATGTAGCTGGCCAAGTGTGG + Intergenic
1070095834 10:73337703-73337725 AAGACCAGCCTGGCCAAATGTGG + Intronic
1070151115 10:73805735-73805757 ATGACCCATCTGTCCAATTATGG - Exonic
1070644788 10:78194443-78194465 AGGGCCTATCTGCCCAATTGAGG + Intergenic
1070684349 10:78469809-78469831 AGGACATATATTGCCAAATGAGG - Intergenic
1071056893 10:81521532-81521554 AAAACATATCTGGACAAATGGGG + Intergenic
1071484397 10:86089107-86089129 ATGACCCAGCTGGGCAAATGGGG - Intronic
1072196683 10:93122063-93122085 AAGACCTCTCTGGCCACATGGGG + Intergenic
1072299063 10:94041450-94041472 ATGACCTTTCAGGCCAAGTCTGG - Intronic
1074224726 10:111473495-111473517 ATGTCCTTTCTGGCCAGGTGCGG - Intergenic
1074448384 10:113539084-113539106 ATGAGCTGTCTGGCCACATGAGG + Intergenic
1074855816 10:117472677-117472699 ATGATCCATCTGCCAAAATGCGG - Intergenic
1076277662 10:129217884-129217906 ATGACCTAAATGTCCAATTGGGG + Intergenic
1078727712 11:13946454-13946476 AAGAAGTATCTGGCCAGATGCGG - Intergenic
1081115443 11:39193495-39193517 AACAACTATCAGGCCAAATGAGG - Intergenic
1085547560 11:77333976-77333998 CTGACCAATATGGCGAAATGTGG + Intronic
1088129935 11:106475413-106475435 ATGACCTTCCTGGCCAAGTAGGG + Intergenic
1091596408 12:1881839-1881861 ATAAGCCATCTGGCCAAATTTGG - Intronic
1094040102 12:26113694-26113716 ATGACCAATTTGCCCAAAAGGGG + Intergenic
1095718776 12:45377389-45377411 ATAACGTATCTGGCCAAATAAGG - Intronic
1095905028 12:47368848-47368870 ATGACTTATTTTGCCAAATCTGG - Intergenic
1097991618 12:65840994-65841016 ATTAACTAGCTGGCCAGATGTGG - Intronic
1098555063 12:71809148-71809170 AGGACCACTCTGGCCATATGTGG + Intergenic
1099321636 12:81158061-81158083 ATGCCCTTTATGGCCATATGTGG - Intronic
1100213520 12:92423463-92423485 ATTATCTATCTGGACAACTGAGG - Intronic
1108320650 13:49286686-49286708 ATTTCCAATCTGGGCAAATGTGG - Intronic
1113191792 13:107757206-107757228 ATGATATATCTGGCAAAGTGAGG + Intronic
1118789899 14:69080877-69080899 ATGAAGTTTGTGGCCAAATGGGG + Intronic
1119556108 14:75554181-75554203 ATGACTTCTGTGACCAAATGTGG + Intergenic
1122681585 14:103468523-103468545 AAGACCAGCCTGGCCAAATGTGG - Intronic
1124038998 15:26082765-26082787 ATGGCCTGACTGGCAAAATGGGG - Intergenic
1126301104 15:47197039-47197061 CTCATCTATGTGGCCAAATGGGG + Intronic
1128749602 15:70139645-70139667 CTTCCCTCTCTGGCCAAATGCGG + Intergenic
1129322112 15:74781235-74781257 ATCACCTATTTTACCAAATGGGG + Intergenic
1129589914 15:76905589-76905611 AAGACCTGTGTGGCCAAAAGCGG - Intergenic
1130050237 15:80478416-80478438 AGGACATTTCTGTCCAAATGTGG - Intronic
1130845328 15:87738769-87738791 ATGAGCTATCTGGACAAGTGCGG - Intergenic
1146108548 17:30065371-30065393 ATGACCTAACTGGCCAGGCGCGG + Intronic
1146138912 17:30347746-30347768 AAGACGTCTCTGACCAAATGTGG - Intergenic
1152160563 17:78665992-78666014 ATAACCTATCGGGTCACATGTGG + Intergenic
1153526385 18:5998552-5998574 CTGACCTCTTTTGCCAAATGGGG - Intronic
1156841133 18:41610793-41610815 ATTACCTATTTTGCCATATGAGG + Intergenic
1162004885 19:7771389-7771411 ATGACCCATGTGGGCAACTGGGG - Intergenic
1167665099 19:50819105-50819127 ATCACCTATCTTTCCAGATGTGG - Intergenic
928105309 2:28467003-28467025 ACCAGCTAGCTGGCCAAATGAGG + Intronic
930724394 2:54668254-54668276 ATGGCGCATCTGGCCAACTGAGG - Intronic
934843691 2:97647572-97647594 ATGAACTATCAGGCATAATGAGG - Intronic
936580902 2:113699724-113699746 AAGACCAGCCTGGCCAAATGGGG + Intergenic
937153636 2:119703001-119703023 ATGCCCTATCTGGCCAGCAGGGG + Intergenic
938277884 2:130043288-130043310 ATGTCATTTCTGGCCATATGTGG + Intergenic
938328849 2:130434089-130434111 ATGTCATTTCTGGCCATATGTGG + Intergenic
938361098 2:130687403-130687425 ATGTCATTTCTGGCCATATGTGG - Intergenic
938437499 2:131294092-131294114 ATGTCATTTCTGGCCATATGTGG - Intronic
945656497 2:212630793-212630815 ATGACATAACTGTCCAAAAGAGG - Intergenic
946935891 2:224720491-224720513 ATAACCTAACTGCCCAAAAGAGG + Intergenic
947490366 2:230589636-230589658 ATGAACTCTCAGGCCCAATGTGG + Intergenic
1181594984 22:23908294-23908316 ATGACCCATGTGGCCAAAGTGGG - Intergenic
1182581783 22:31317972-31317994 ATGAGCTATCAGGCCGCATGTGG + Intergenic
1183224061 22:36537209-36537231 ATGACCTATCTGGGCTAAAATGG + Intergenic
1184982564 22:48104722-48104744 ATGGCTTGTGTGGCCAAATGTGG + Intergenic
951668442 3:25153350-25153372 ATGAGCTGTCTGCCAAAATGTGG + Intergenic
952075384 3:29690157-29690179 ATGACATATCTGGCCAGGCGTGG + Intronic
954046387 3:47934796-47934818 ATGAATTATCTGGACAAATGTGG - Intronic
955776285 3:62437261-62437283 ATGAAATATCTGGCTAAATTAGG + Intronic
956861886 3:73332760-73332782 ACAACGTATCTGGCTAAATGTGG + Intergenic
958871470 3:99563898-99563920 TTGACATATATGGCCAAAGGAGG + Intergenic
959026129 3:101241735-101241757 ATGACTTCTCTGGCCAGGTGCGG + Intronic
959249729 3:103926537-103926559 AGGACAGATCTGGCCACATGTGG - Intergenic
964165632 3:153701756-153701778 CTGACCTATGGGGCCAAATCTGG + Intergenic
964237570 3:154550898-154550920 AAGACAGATCTGGCCAAATCTGG + Intergenic
967020321 3:185516842-185516864 ATGTCCTGACTGGTCAAATGGGG - Intronic
970509004 4:16761850-16761872 ATGAACTTTATGGCCAGATGTGG + Intronic
970815749 4:20154551-20154573 ATGAACTATGTGCCCCAATGTGG + Intergenic
979005100 4:115284441-115284463 ATCACTTATCTAGGCAAATGGGG - Intergenic
979726525 4:123969178-123969200 ATGACCTATGTGGTGGAATGTGG + Intergenic
981057175 4:140374508-140374530 AGGAACTGTTTGGCCAAATGAGG - Intronic
987926605 5:24350278-24350300 ATGCCTTATCTGGGCTAATGTGG - Intergenic
990965837 5:61446953-61446975 ATTACCTATCAGTGCAAATGAGG - Intronic
993927404 5:93886279-93886301 CTGACCTCTCTGGTCACATGTGG - Intronic
998922547 5:147085511-147085533 ATGAGCTCTCTGGCAAATTGGGG - Intergenic
1006882616 6:37353381-37353403 GTGACCAACCTGGCCACATGGGG - Intergenic
1010878516 6:81138782-81138804 GTGACCCATCTGGCCACAGGAGG - Intergenic
1017797271 6:157857201-157857223 ATGAGCTTGCTGTCCAAATGTGG - Intronic
1023488786 7:40715171-40715193 ATGCCCTATCTGTACAAATTTGG - Intronic
1027906654 7:84193644-84193666 AAGACCTATCTAAGCAAATGTGG + Intronic
1028426795 7:90698561-90698583 ATGTCCTATCTGATCAAAGGAGG - Intronic
1031392057 7:121227157-121227179 ATGACCTATATGGCCAACGCTGG - Intronic
1035414657 7:158672956-158672978 ATGACCCATCTGGGCAAGGGAGG + Intronic
1041535513 8:58921036-58921058 AGGACCTATCTTGCCTTATGTGG + Intronic
1046963075 8:120130336-120130358 ATGACCTATCTGGCCAAATGTGG - Intronic
1048125006 8:131624713-131624735 ATGACCTGTCTAGGCCAATGGGG - Intergenic
1048515835 8:135110537-135110559 TTGACCTCTCTGGCAAAATTAGG + Intergenic
1048744638 8:137600234-137600256 ATTATCCATCTGGCCAAATTTGG - Intergenic
1049079672 8:140432163-140432185 AAGACCTTTCTGGCCATAGGTGG - Intronic
1052805153 9:33006708-33006730 AAGACCTATCTGGCCGGGTGCGG + Intronic
1059866127 9:118515710-118515732 ATGACATATCTGGGGAAAAGGGG + Intergenic
1189567128 X:42254653-42254675 CTGATCTATCTGTCCAAGTGGGG - Intergenic
1192958024 X:76094378-76094400 TTGACCTATCTTGCTAAATTGGG + Intergenic
1196187093 X:112755911-112755933 ATGTCCTAACTGGGGAAATGAGG + Intergenic
1197483771 X:127021161-127021183 AAGACCTATCTTCCTAAATGAGG + Intergenic
1200297289 X:154933361-154933383 ATAAGCTATCTGGCCAAGTTGGG + Intronic