ID: 1046968034

View in Genome Browser
Species Human (GRCh38)
Location 8:120189294-120189316
Sequence AGAGCTGCTAACCTGGATTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046968029_1046968034 26 Left 1046968029 8:120189245-120189267 CCTTATGATGGAAATAGCCATTA 0: 1
1: 0
2: 0
3: 14
4: 131
Right 1046968034 8:120189294-120189316 AGAGCTGCTAACCTGGATTTAGG No data
1046968032_1046968034 9 Left 1046968032 8:120189262-120189284 CCATTAGGGTTCATTGTGTTTAT 0: 1
1: 0
2: 0
3: 11
4: 206
Right 1046968034 8:120189294-120189316 AGAGCTGCTAACCTGGATTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046968034 Original CRISPR AGAGCTGCTAACCTGGATTT AGG Intronic
No off target data available for this crispr