ID: 1046968718

View in Genome Browser
Species Human (GRCh38)
Location 8:120196007-120196029
Sequence GGGGAAATGCAGAAGGTGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 621
Summary {0: 1, 1: 0, 2: 9, 3: 42, 4: 569}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046968718_1046968721 -5 Left 1046968718 8:120196007-120196029 CCATTCACCTTCTGCATTTCCCC 0: 1
1: 0
2: 9
3: 42
4: 569
Right 1046968721 8:120196025-120196047 TCCCCAGCATTGCTGTGAGTGGG No data
1046968718_1046968727 20 Left 1046968718 8:120196007-120196029 CCATTCACCTTCTGCATTTCCCC 0: 1
1: 0
2: 9
3: 42
4: 569
Right 1046968727 8:120196050-120196072 CTTCTCTAATAGTAAAACATAGG No data
1046968718_1046968723 -4 Left 1046968718 8:120196007-120196029 CCATTCACCTTCTGCATTTCCCC 0: 1
1: 0
2: 9
3: 42
4: 569
Right 1046968723 8:120196026-120196048 CCCCAGCATTGCTGTGAGTGGGG No data
1046968718_1046968720 -6 Left 1046968718 8:120196007-120196029 CCATTCACCTTCTGCATTTCCCC 0: 1
1: 0
2: 9
3: 42
4: 569
Right 1046968720 8:120196024-120196046 TTCCCCAGCATTGCTGTGAGTGG No data
1046968718_1046968728 28 Left 1046968718 8:120196007-120196029 CCATTCACCTTCTGCATTTCCCC 0: 1
1: 0
2: 9
3: 42
4: 569
Right 1046968728 8:120196058-120196080 ATAGTAAAACATAGGTACCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046968718 Original CRISPR GGGGAAATGCAGAAGGTGAA TGG (reversed) Intronic
900145205 1:1156267-1156289 GGGGAAATGGAGGGGGTGGATGG - Intergenic
900344109 1:2203070-2203092 GGAGAAAAGCAGAAGGGGGATGG - Intronic
900632036 1:3641838-3641860 GCAGAAATGTAGAAGGTAAAAGG + Intronic
900686366 1:3950684-3950706 GGGGAGATGCAAAAGGGGAATGG + Intergenic
902768871 1:18634268-18634290 GGGGAGATGCAGAAGGAGAGAGG - Intronic
903555644 1:24191204-24191226 GGGGAACTTCAAAAGGTGGATGG - Intergenic
904197275 1:28795212-28795234 GGGGAAATGCATTAGGAGAATGG - Intergenic
904219121 1:28950587-28950609 GGAGAAAGGCAGAAGGCCAAAGG + Intronic
904978904 1:34480033-34480055 GGGGCAATGCAGGAGGAGGAGGG + Intergenic
905677022 1:39833799-39833821 GGGTAAATGGAGAAGTTTAATGG - Intergenic
906319435 1:44807233-44807255 GGCCAAAGGCAGAAGGTGGAAGG - Intergenic
906520192 1:46462172-46462194 GAGGAAATGCAGAACAAGAAGGG - Intergenic
907098326 1:51802693-51802715 GGGGAGATGGAGAAGGGAAAAGG + Intronic
907628481 1:56055635-56055657 GGTGGAATGCAGAAGGGTAAAGG - Intergenic
907727155 1:57030239-57030261 GGGGAGAGGCAGAAGGCAAAGGG - Intronic
908023230 1:59920283-59920305 GGGGAAATGCAGAAGGTGTTTGG + Intronic
909526292 1:76626534-76626556 TGGGAAATGCAGGAACTGAAGGG - Intronic
910022103 1:82604129-82604151 GGGGAAATTGAGAATGTAAAAGG - Intergenic
910505729 1:87948308-87948330 GAGGAAAGGAAGAGGGTGAAGGG + Intergenic
910576422 1:88769974-88769996 GGGTAACTGTAGAAGGTGATGGG + Intronic
911601274 1:99850316-99850338 GGGGAGAAACAGAAGGGGAAGGG - Intronic
911828580 1:102520450-102520472 CATGAAGTGCAGAAGGTGAATGG - Intergenic
911934205 1:103946565-103946587 GGGGAAATGCAGAGTCGGAATGG + Intergenic
912273159 1:108230287-108230309 GGAGAAATGCAAAATGGGAAAGG + Intronic
912273172 1:108230412-108230434 GGAGAAATGCAAAATGGGAAAGG + Intronic
912295048 1:108463910-108463932 GGAGAAATGCAAAATGGGAAAGG - Intronic
912295061 1:108464035-108464057 GGAGAAATGCAAAATGGGAAAGG - Intronic
915448915 1:155990959-155990981 GGGGAAATAAAGGAGGGGAATGG - Intronic
916323349 1:163530446-163530468 GAAGAAATGGAGAAGGAGAAGGG - Intergenic
916420576 1:164634288-164634310 AGGGCACTGCAGAAGGTCAACGG - Intronic
916433226 1:164752444-164752466 GGGAGAATGCAGAATGTGGAAGG + Intronic
917783073 1:178420484-178420506 AAGGAAAGGCAGAAGGTGATGGG - Intronic
918543532 1:185657589-185657611 GGGGAAAGGGAGAAGGGAAAAGG - Intergenic
918799338 1:188953002-188953024 GAGAAAATGCTGAATGTGAATGG + Intergenic
918888974 1:190238995-190239017 GGCCGAAGGCAGAAGGTGAAGGG + Intronic
918989305 1:191677479-191677501 GGGGAAGTGGGGAAGGTTAATGG - Intergenic
919210359 1:194474942-194474964 ATGAAAATGCAGAAGGTGACTGG + Intergenic
919802275 1:201361142-201361164 GGGCAGATGCAGGAGCTGAAGGG + Intronic
920081178 1:203373842-203373864 GAGGAAATACAGAAGGGAAAAGG - Intergenic
920107183 1:203562259-203562281 TGGGAAATGCAGAAGGGTGAGGG - Intergenic
920330232 1:205202077-205202099 GGGGAAAGGGAGAAGGGGAAGGG + Intronic
920330243 1:205202103-205202125 GGGGGAAGGGAGAAGGGGAAGGG + Intronic
920441118 1:205980877-205980899 GGGGAAGCGGAGGAGGTGAAGGG - Intronic
920859564 1:209694369-209694391 TGGGAAAGGCAGACAGTGAATGG + Intronic
921485846 1:215714612-215714634 GGGGAAATGGAGAAGGAAAAAGG + Intronic
922595620 1:226810662-226810684 TGAGAAATGCAGAATGTGATGGG + Intergenic
923596061 1:235361541-235361563 GGGGAAATGCTCCAGGTGGAGGG - Intergenic
1062818515 10:517189-517211 GGAGAAATGGAGAAGGGAAAAGG - Intronic
1063278299 10:4595845-4595867 GGGGAAATGAGGAAGGCCAATGG + Intergenic
1063687750 10:8254767-8254789 GATGAAATGCAGAAGGGGAGAGG + Intergenic
1063730124 10:8687097-8687119 GGGGAAAAGCAGAAGATAGAAGG - Intergenic
1064487469 10:15809606-15809628 GGTGAAATGCAGTACGTAAATGG - Intronic
1065338354 10:24678420-24678442 GGGGACATGTAGGAGGTGGAGGG - Intronic
1066278493 10:33891623-33891645 AGGAAAATGCAGCAGCTGAAGGG + Intergenic
1067457473 10:46430217-46430239 TGGGAAATGGAGATGGTTAATGG - Intergenic
1067547955 10:47209137-47209159 GGGACAATGGAGAAGGTGTAGGG + Intergenic
1067629723 10:47954417-47954439 TGGGAAATGGAGATGGTTAATGG + Intergenic
1067784716 10:49237035-49237057 GAGGAATTGGAGAAGGTCAAGGG - Intergenic
1068103469 10:52584730-52584752 GGGGAAGTGGAGATGGTTAATGG - Intergenic
1068260146 10:54570126-54570148 GTGGAAATTCATAAGGAGAATGG + Intronic
1068411952 10:56667616-56667638 GGGGAAAGGGGGAAGGGGAAAGG - Intergenic
1068773443 10:60847259-60847281 GGGGAACTGCAGAGGGTGGTTGG + Intergenic
1069187395 10:65442078-65442100 GCAGAATTGGAGAAGGTGAAGGG - Intergenic
1069323150 10:67198983-67199005 GGGGAGATGGAGGAGGAGAAAGG + Intronic
1069846385 10:71374655-71374677 GGAGAAAGGCAGCTGGTGAAAGG + Intergenic
1070199134 10:74186235-74186257 GGGGAAAGGCGGAAGGGGAAGGG - Intronic
1070270782 10:74952479-74952501 GGGGAAAGCCAGAGAGTGAAGGG + Intronic
1070389710 10:75958845-75958867 GGTGGAAGGCTGAAGGTGAAAGG + Intronic
1071976850 10:90964205-90964227 GGGGAAATGCAGCTGAAGAATGG + Intergenic
1072197681 10:93130627-93130649 GGAGGAATGGAGAAGGGGAAAGG - Intergenic
1072288551 10:93940800-93940822 GAGGAACAGCAGAAGGCGAAAGG - Intronic
1072914174 10:99527019-99527041 GGGGAAGGGCAGAAGGGAAAAGG + Intergenic
1073131032 10:101189518-101189540 GGGGAAAGGCAGGAGGTGCCTGG - Intergenic
1073748305 10:106494878-106494900 GGGGACATGGAGGAGGTGAGAGG - Intergenic
1073967468 10:109007819-109007841 AGGGAAATGTGGAAGGTGCAAGG + Intergenic
1074440125 10:113470848-113470870 GGGGAAATACAGAAGGGTCATGG + Intergenic
1074619413 10:115103665-115103687 GGGGAAATGGGGATGGTTAATGG - Intronic
1075585429 10:123653776-123653798 GGGGGAATGGGGAAGGGGAAGGG + Intergenic
1075864871 10:125709132-125709154 GGGGAATTGCAGAAGAGTAATGG - Intergenic
1076257975 10:129043798-129043820 GGGGAAGGGCAGATGGTGAAAGG - Intergenic
1076485910 10:130816844-130816866 TGGGAACTGCAGCAGGTGGAGGG - Intergenic
1077230529 11:1456474-1456496 GGGGAGGCGCAGAAGGAGAACGG + Exonic
1077371923 11:2186300-2186322 GGGGATGTGGAGAAGGTGAGAGG - Intergenic
1077530533 11:3092759-3092781 GGGGACAGGCTGAAGGTGAGAGG + Intronic
1077615483 11:3670833-3670855 GGGGAAAGGGAGACAGTGAAGGG - Intronic
1078294639 11:10055772-10055794 GGGGAAATGGGGAAGGTAGATGG + Intronic
1079082962 11:17427067-17427089 GGGGAGATGCAGAAGGTCTCAGG - Exonic
1080175148 11:29354411-29354433 AGGGCAATGCAGATGGTGACAGG + Intergenic
1080517149 11:33034927-33034949 GGGGAAAGGTGGAAGGAGAAAGG - Intergenic
1080599367 11:33807587-33807609 AGGGGAATTCAGAAGGTGACAGG - Intergenic
1080758267 11:35223262-35223284 GGGAAAATGAGGAAGCTGAAGGG - Intronic
1081685226 11:45037785-45037807 GGGCAAAGGCAGAAACTGAATGG - Intergenic
1081876268 11:46410386-46410408 AGGGTAAAGAAGAAGGTGAAAGG + Intronic
1083902505 11:65650465-65650487 GAGGACCTGCAGAAGGTGAGGGG + Exonic
1084516387 11:69640075-69640097 GGGCAAATTCTAAAGGTGAAGGG + Intergenic
1085262905 11:75218507-75218529 GAGTGAATGCAGAAGGAGAAAGG + Intergenic
1085518304 11:77123901-77123923 GGGGACATGCAGATGGTGGTGGG - Exonic
1085699017 11:78729743-78729765 AGGGAAAGGCAGAAGGAGAGAGG + Intronic
1085951804 11:81341479-81341501 GGATAAATGCAGAAGGAAAATGG - Intergenic
1086190813 11:84076662-84076684 GGGGCAGTGAAGAAGGTGGAGGG - Intronic
1086320250 11:85638780-85638802 GGGGAAAATCACATGGTGAAGGG - Intergenic
1086831297 11:91568329-91568351 GGGGAATTGTAGAAGATAAATGG - Intergenic
1087011742 11:93520834-93520856 CGTGACATGCTGAAGGTGAAAGG - Intronic
1087077477 11:94138762-94138784 GGGGAAATGGGGATGGTTAATGG - Intronic
1088741536 11:112771446-112771468 GGAAAAAAGCAGAAGGGGAAAGG + Intergenic
1090325429 11:125882281-125882303 AGGGAAGTGAAGAGGGTGAAAGG - Intergenic
1090397576 11:126429374-126429396 GGGGAAATGCAGAGGGTGGCAGG - Intronic
1090485563 11:127109161-127109183 AGAGAAAGGCAGAAGGAGAAAGG - Intergenic
1090817651 11:130314005-130314027 GAGAAAAAGCAGAAGGGGAAAGG + Intronic
1091203758 11:133803014-133803036 GGAGACATGCAGAAATTGAAGGG + Intergenic
1091446761 12:548191-548213 GGGTAGATGCAGAAGGTGGGAGG - Intronic
1091617285 12:2059219-2059241 GCTGAGATGCAGAAGGTGAGGGG + Intronic
1091715787 12:2775276-2775298 GGGAAAAGGCAGAAGGTTCAAGG - Intergenic
1091862808 12:3801811-3801833 TGGGAAATGCAGAAAGCCAAGGG - Intronic
1092014914 12:5150543-5150565 GGGGTAGTGCAGAGGGCGAAGGG - Intergenic
1092218767 12:6699561-6699583 GGGGAAACGGAGAGGATGAAGGG + Intronic
1092230313 12:6772471-6772493 GGGGAAGTGGGGAAGGTGGAGGG + Intergenic
1092329721 12:7572933-7572955 TGAGAAGTGAAGAAGGTGAAAGG - Intergenic
1092580483 12:9835703-9835725 AGGAACATGGAGAAGGTGAAGGG + Intronic
1092777101 12:11953322-11953344 GTGGAGTTACAGAAGGTGAAGGG + Intergenic
1092913885 12:13172205-13172227 GGGCAATTGCTGAAGGTCAAAGG + Intergenic
1093264371 12:16984307-16984329 GTGGAAATGCAGAACATTAAAGG + Intergenic
1093627562 12:21367426-21367448 GGAGAAAAGCAGAAGGTCAGAGG + Intronic
1093919262 12:24841463-24841485 GGGGAACTGCAGAAGGGATAAGG + Intronic
1094084737 12:26577014-26577036 GGGGGAAGGCAGAAGGTGGAAGG - Intronic
1094490953 12:30960313-30960335 CGGGAAATGCACAGGGTGATGGG - Intronic
1095692409 12:45105121-45105143 GGGGAAAAGTAGAGGGTGTATGG - Intergenic
1095807374 12:46334873-46334895 GGGGAATTGCGGATGGTTAACGG - Intergenic
1095814409 12:46405898-46405920 GGGGAATTGAAGAAAGGGAAAGG + Intergenic
1095942560 12:47736506-47736528 GGGGAAGTGCTGAAGGGGCAGGG + Intronic
1096203815 12:49705705-49705727 GGGGAAATGCAGAGGGCCACAGG + Intronic
1096621698 12:52869468-52869490 GGGGAAATGAAGAATGTGCGAGG + Intergenic
1097160280 12:57041466-57041488 GGGGAAAAGAAGAAGGTAATGGG - Exonic
1097548113 12:61030457-61030479 GTGGAAAGGCAGAAGGGCAAAGG - Intergenic
1098535653 12:71591342-71591364 TGAGAAATCCATAAGGTGAAGGG - Intergenic
1098675041 12:73279359-73279381 GGGGCATTGTAGAAGGTGATTGG + Intergenic
1100739795 12:97579472-97579494 AGGGAAAGGCAGAAGAGGAAAGG - Intergenic
1101025642 12:100602766-100602788 GGGGAAGTGGAGATGGTTAAGGG - Intronic
1101432501 12:104638135-104638157 GGGGAAAAGGAGGAGGAGAAAGG + Intronic
1101608144 12:106265786-106265808 GGGGAAGTGGAGATGGTTAATGG + Intronic
1101685673 12:107017621-107017643 GGGGAAAAGTAGAAGCTGAAAGG + Intronic
1101972855 12:109328597-109328619 CATGAAATGCAGAAGGGGAAAGG - Intergenic
1102402391 12:112640861-112640883 GGGAAAATGCTGAAGGAGAAGGG - Intronic
1104238178 12:126960169-126960191 GAGGAAAAGCAGAAGGTTCAGGG - Intergenic
1104844505 12:131840159-131840181 GGGGGACAGCAGAAGGTGAGTGG - Intronic
1106095848 13:26642513-26642535 TGGGAAATACAGAAGGAGAAAGG - Intronic
1106624694 13:31408663-31408685 GGGAAAATGCAGAAAAGGAAAGG + Intergenic
1107033619 13:35878527-35878549 GGGGAAATGGGGATGGTTAATGG + Intronic
1107518171 13:41152250-41152272 AGGGAACTGCGGAAGGAGAATGG + Intergenic
1107835183 13:44407129-44407151 GGGGAAAAGCATCGGGTGAAAGG - Intergenic
1108166878 13:47702464-47702486 GGAAAAACCCAGAAGGTGAAGGG + Intergenic
1108265775 13:48707245-48707267 GGTGACATGCAGAAGCCGAAAGG - Exonic
1108344100 13:49527362-49527384 GTGGAAATGCAGAGTGTGGAGGG - Intronic
1111231671 13:85352579-85352601 GGAGAAATGAAGGAGGTGTAAGG - Intergenic
1111685211 13:91493466-91493488 GGAGAAATGGAGATGGTTAATGG - Intronic
1111967921 13:94879767-94879789 GGGGGAATTAGGAAGGTGAAGGG - Intergenic
1112097984 13:96156395-96156417 GGAGAAATCCAGAGAGTGAAAGG + Intronic
1113271270 13:108677129-108677151 GGGGATGTGCAGAAGGAGGAGGG + Intronic
1114450058 14:22819581-22819603 GGGGAAGTGCAGGAGGAGGATGG - Intronic
1114847285 14:26338515-26338537 GGGGAAAACTAGAAGGTCAAGGG - Intergenic
1114941217 14:27612850-27612872 TGGGAAATGCACAAGGGGAGAGG - Intergenic
1115044500 14:28974699-28974721 TGGGAAATGCACAGGATGAATGG - Intergenic
1115053065 14:29088727-29088749 GGGGAAATGGGGATGGTTAATGG + Intergenic
1115678480 14:35709095-35709117 GGGTAAGTGCAGATGGTTAATGG + Intronic
1115744528 14:36422445-36422467 GGGGAAATGGAGATGATGCATGG + Intergenic
1116194205 14:41701668-41701690 AGGGAAATGCAGAATGTGATAGG + Intronic
1116506103 14:45683724-45683746 GGGGAAGAGCAGAGGGTTAATGG - Intergenic
1116883603 14:50196540-50196562 GGGGAAATGGGGATGGTTAATGG - Intronic
1117752877 14:58941599-58941621 GGGATAATGCAGATTGTGAAGGG + Intergenic
1118089614 14:62458844-62458866 GGGGGAGTGGAGAAGGGGAATGG - Intergenic
1118232761 14:63968958-63968980 GGGGAAATGGAGATGGTTAATGG - Intronic
1118342527 14:64906855-64906877 CGGGAGATGGAGAAGGAGAAAGG - Intergenic
1118667445 14:68086154-68086176 GGGGGAAGCCAGAAGGGGAATGG + Intronic
1119851829 14:77871722-77871744 GGGGTCATGCAGGAGCTGAAGGG + Intronic
1119857464 14:77911279-77911301 AGGGAAATGGAGAAGGTAGAGGG - Intronic
1120307312 14:82787167-82787189 GGAGAAGTGCAGAGCGTGAAGGG + Intergenic
1120540888 14:85748969-85748991 TTGAAAATGAAGAAGGTGAAGGG + Intergenic
1120668638 14:87337814-87337836 GGGGAAGTGGAGAGGGTTAATGG - Intergenic
1121295330 14:92816368-92816390 GAGGAAATACAGAAGCTGATGGG + Exonic
1121637703 14:95465085-95465107 GAGGAAATGCAGACAGAGAATGG + Intronic
1122007277 14:98715992-98716014 GGGGAGGTGCAGCAGGTGAGGGG + Intronic
1122579488 14:102762478-102762500 GGGGAAATGCTGGGGGGGAATGG + Intergenic
1123480002 15:20622415-20622437 AGGGAAATTCACAAGGTGAGAGG - Intergenic
1123632071 15:22268444-22268466 GGTGGAAGGCAGAAGGGGAAAGG - Intergenic
1123638005 15:22377949-22377971 AGGGAAATTCACAAGGTGAGAGG + Intergenic
1123815187 15:23971085-23971107 GTGGAGATGCAGAGAGTGAAAGG + Intergenic
1124079063 15:26474582-26474604 TGGGAAATGAAGAAGCTGAAAGG - Intergenic
1125618160 15:41034715-41034737 GGGGAAATGTAAAAGTTGGAAGG - Intronic
1125705816 15:41734939-41734961 GGGGAAATCTAGAAGGAGAAAGG + Intronic
1126171569 15:45699591-45699613 GGCAATGTGCAGAAGGTGAAGGG - Intergenic
1126196478 15:45937272-45937294 GGGGATATGCAGAAGGGTGATGG - Intergenic
1126441188 15:48690804-48690826 AGGGAAATGGAGATGGTTAATGG + Intergenic
1126669015 15:51099430-51099452 AGGGAAATTGAGAAGGAGAAAGG + Intronic
1126904874 15:53353913-53353935 GGGGAAGTGAAGAGGGTTAATGG - Intergenic
1127873008 15:63088862-63088884 GGGGGAAGGCTGAAGGTCAAAGG + Intergenic
1127980194 15:64029381-64029403 GGGCATGTGGAGAAGGTGAAGGG - Intronic
1128047823 15:64634625-64634647 GGGGCAAGACTGAAGGTGAAGGG - Intronic
1128213299 15:65916967-65916989 GGTGAAATGCAGAGGGTGAGGGG + Intronic
1128987838 15:72234266-72234288 GGGGAAAAGGAACAGGTGAAAGG - Intergenic
1129044958 15:72725927-72725949 GGGGAAAGGGGGAAGGGGAAAGG - Intronic
1129162360 15:73753579-73753601 GGGGCAGTGCAGTAGGGGAAGGG - Intergenic
1131709438 15:95037357-95037379 GGGGAAAGACAGAAGATGAAAGG + Intergenic
1131727203 15:95239634-95239656 AAGGAAGTGCATAAGGTGAAGGG - Intergenic
1131804066 15:96103712-96103734 GGGGAAATGCAGACAGCAAAAGG + Intergenic
1132867876 16:2102817-2102839 GGGGAAATGAAGAAGGTGTAGGG + Exonic
1134232308 16:12438409-12438431 GGGTAAATGAAGAAGGGGAGAGG - Intronic
1134507172 16:14817562-14817584 GGGGAAATGGGGATGGTTAATGG - Intronic
1134523897 16:14930297-14930319 GGGGAAATGAAGAAGGTGTAGGG - Intronic
1134549007 16:15130638-15130660 GGGGAAATGAAGAAGGTGTAGGG + Intronic
1134694873 16:16216319-16216341 GGGGAAATGGGGATGGTTAATGG - Intronic
1134711488 16:16328782-16328804 GGGGAAATGAAGAAGGTGTAGGG - Intergenic
1134719339 16:16372081-16372103 GGGGAAATGAAGAAGGTGTAGGG - Intergenic
1134948087 16:18339804-18339826 GGGGAAATGAAGAAGGTGTAGGG + Intergenic
1134955341 16:18379911-18379933 GGGGAAATGAAGAAGGTGTAGGG + Intergenic
1135027510 16:19010103-19010125 GGGGAAAGGGGGAAGGGGAAAGG - Intronic
1136223379 16:28843238-28843260 GGGAGAATGCAGCAGGGGAATGG + Intronic
1136419500 16:30123112-30123134 GGGGAGGTGGAGATGGTGAAGGG - Exonic
1136940305 16:34518290-34518312 GGGAAACTTCAGAAGGCGAAAGG + Intergenic
1136959515 16:34830280-34830302 GGGAAACTTCAGAAGGCGAAAGG - Intergenic
1137634918 16:49977829-49977851 AGGGAAAGGGAGAAGATGAATGG + Intergenic
1137638290 16:50006566-50006588 GGGGAAATACAGGGGGTGCAGGG + Intergenic
1138256818 16:55571903-55571925 GGTAAAATGAAGAAGTTGAATGG + Intronic
1138371237 16:56528170-56528192 GGGGAGATGGGGATGGTGAATGG + Intergenic
1138817101 16:60215177-60215199 GTGAAACTTCAGAAGGTGAAGGG - Intergenic
1139459641 16:67111282-67111304 CTGGAAATGGAGAGGGTGAAGGG - Intronic
1139593687 16:67946596-67946618 ATGGAAATTGAGAAGGTGAAGGG - Exonic
1139643386 16:68309955-68309977 GAAGACTTGCAGAAGGTGAATGG - Intronic
1140247795 16:73267168-73267190 GCGGAAGGGCAGAAGGAGAAGGG + Intergenic
1140546269 16:75812831-75812853 GGGGAAGTGGGGAAGGTTAATGG - Intergenic
1140622400 16:76751427-76751449 AGTGAACTGCAGAAGGAGAAGGG + Intergenic
1140873968 16:79133244-79133266 GGGGAAGGTCAGAAGATGAAGGG - Intronic
1141970924 16:87481943-87481965 GGTGGAAGGCAGAAGGGGAAAGG + Intronic
1142145848 16:88492664-88492686 GTGGACATCCAGAAGGTGGACGG + Intronic
1143180395 17:4980797-4980819 GGGGAAATGGAGAGGGGGAGGGG - Intronic
1143647401 17:8239849-8239871 GAGCAGATGCAGAAGGGGAATGG - Intronic
1143653601 17:8279785-8279807 GGGACAATGCACAAGGTGGAGGG - Intergenic
1143877278 17:10001563-10001585 GGGGAAATACAGAGCCTGAAAGG + Intronic
1144227570 17:13164947-13164969 GGGGAGATGGAGATGGTTAATGG + Intergenic
1146766856 17:35530611-35530633 GGGGAAATGAAGATGGCCAAGGG + Intronic
1148649023 17:49236318-49236340 GGGGAAAGGAAGGAGGAGAAAGG + Intergenic
1148966165 17:51437862-51437884 AGGGAGATGGAGAAGGGGAAAGG + Intergenic
1149454462 17:56776783-56776805 GCTGGAATGGAGAAGGTGAATGG - Intergenic
1149664504 17:58356413-58356435 GGGGAAGAGTAGAAGGTGGAAGG + Intronic
1149667238 17:58373790-58373812 GGGGAGATGGAGATGGTTAATGG - Intronic
1149690042 17:58567873-58567895 GCTGAAATGGAGGAGGTGAATGG + Intronic
1149902893 17:60497369-60497391 GGGCAAATGAAGATGGTTAATGG + Intronic
1150601365 17:66653681-66653703 GGGGAGATGCAGAATGCAAACGG - Intronic
1150965643 17:69964929-69964951 AGGCAGATGCAGAAGATGAAAGG - Intergenic
1152070286 17:78130873-78130895 GGGAGAATGCAGAGGGTGAGGGG + Intronic
1153512419 18:5870016-5870038 GGGCAAAAGCAGAAGCTAAAAGG + Intergenic
1153853529 18:9121133-9121155 GGGGAAAGGCAGGAAGTGTAGGG + Intronic
1156133867 18:34011989-34012011 AGGAAAATGAAGAAGGTGAGGGG - Intronic
1156501098 18:37558884-37558906 TGGGAAATGCAGTGGGTGAAGGG + Intronic
1157000401 18:43515785-43515807 GAGAAAATGCAGAATGTGAAAGG - Intergenic
1157479437 18:48044150-48044172 AGAGAAATGCAGAAGTGGAATGG - Intronic
1157839619 18:50944522-50944544 GGAGGCATGCAGAAGGTGACTGG - Intronic
1158777962 18:60609994-60610016 TGGGAAATGTAGTAGGGGAAAGG - Intergenic
1159263226 18:66043678-66043700 GGGGAAAAGCAGAAGTAGAGTGG - Intergenic
1159309445 18:66688027-66688049 GGGGAAAGACTGAAGATGAATGG - Intergenic
1162491014 19:10991695-10991717 TGGGAAAAGGAGAAGGTGCAAGG + Intronic
1162576382 19:11501474-11501496 GGGGAAATGAAGAAGGAGGCTGG - Intronic
1162698303 19:12494646-12494668 GGGGAAGTGAAGATGGTTAATGG + Intronic
1163401939 19:17099356-17099378 TGGGGACTGCAGAAGGTGATGGG + Intronic
1163782394 19:19257394-19257416 AGTGAGATGCAGAAGGTGTACGG + Exonic
1164010640 19:21200733-21200755 GTGGCAATGCAGGAGGTAAAAGG - Intergenic
1164017022 19:21262343-21262365 GTGGCAATGCAGGAGGTGCAAGG + Intronic
1164082628 19:21873698-21873720 GTAAAGATGCAGAAGGTGAAAGG - Intergenic
1164292215 19:23879025-23879047 GGAGAGAAGAAGAAGGTGAAGGG + Intergenic
1164443385 19:28297319-28297341 GGGGAATACAAGAAGGTGAAGGG + Intergenic
1164452413 19:28378219-28378241 GGGGAAAAGGAGAAGGTGATGGG - Intergenic
1165646212 19:37439923-37439945 GGGGAAATGGGGATGGTTAATGG + Intronic
1166219771 19:41356958-41356980 GGGGAAAGGCAGAAGGGGACAGG - Intronic
1166334859 19:42099631-42099653 GGGGAAATACACAGGGTGAGGGG + Intronic
1167652613 19:50741220-50741242 TGGGAATTGCTGAAGGTGCAGGG - Intergenic
1167669340 19:50840695-50840717 GGGGAAGTGCGGATGGTTAATGG + Intergenic
1168296517 19:55379624-55379646 GAAGACATGCAGAAGGGGAAAGG + Intronic
924996055 2:362618-362640 AGGGACATGCAGAAGATAAAGGG + Intergenic
925070044 2:959629-959651 GGCTGAATGGAGAAGGTGAACGG + Intronic
925232791 2:2250534-2250556 GGGGAAGTGGGGATGGTGAAAGG + Intronic
925663067 2:6223169-6223191 GGGGAAAAAGAGAAGGTGTATGG - Intergenic
926276525 2:11407384-11407406 GGCTAACTGCAGAAGGTGAATGG + Intergenic
927882927 2:26701371-26701393 AGGGAAGTGGAGAAGGTGGATGG + Intronic
928418929 2:31122225-31122247 CGGGATAAGCAGAACGTGAAGGG + Intronic
928467670 2:31537879-31537901 GGAGGAAGGCAGAAGGTGAAAGG - Intronic
928786615 2:34894715-34894737 GGAGAAATGCAGTAGGTATAGGG - Intergenic
928794277 2:34997437-34997459 GGGGAGATGCAGACGATTAAAGG - Intergenic
928808293 2:35189331-35189353 GGGGCATTTCAGAAGGTGGAAGG - Intergenic
930041043 2:47124381-47124403 GGGGAAGTGGAGATGGTTAATGG - Intronic
930048889 2:47198398-47198420 GGGGAAGTGGAGATGGTTAATGG + Intergenic
931096574 2:58947381-58947403 GGGGAAAAGGAGCAGGAGAAAGG - Intergenic
931510066 2:62981807-62981829 GGTGAAATGAAGAAGGGGCAGGG + Intronic
931908561 2:66869428-66869450 AGGGAACTGCAGAAGGAGTAAGG + Intergenic
933007469 2:77014234-77014256 AGGCAAAGGCAGATGGTGAAAGG + Intronic
933270959 2:80232440-80232462 TGGGAGATGAAGAAGGAGAAGGG - Intronic
936826657 2:116589692-116589714 GGGGAAATGCGGAAGCGAAAGGG + Intergenic
936864317 2:117059167-117059189 GGGGAAATGAAGAAAATGGAAGG - Intergenic
936898501 2:117456943-117456965 GGGGAAGTGGAGATGGTTAAGGG - Intergenic
937463781 2:122111682-122111704 GGGGGGATGCAGCAGGTGACAGG - Intergenic
937549035 2:123063785-123063807 GAGGAGGTGGAGAAGGTGAAAGG + Intergenic
938034641 2:128026868-128026890 GGGAAGATGGAGAAGGTGTAGGG - Intronic
940007938 2:149026166-149026188 TGGGAAAGGCAGAGGGTGGAGGG + Exonic
940087098 2:149872706-149872728 GAGGAAATGAAGTAGGTGACAGG + Intergenic
940371557 2:152907456-152907478 GGGGAAAGGAAGAAGGTTTAAGG - Intergenic
940646361 2:156396709-156396731 GGGGAAATGGGGAAATTGAAAGG + Intergenic
941770529 2:169340563-169340585 GTGGGATTGCAGAAGGAGAAAGG - Intronic
942168377 2:173264861-173264883 GGGGAAATGGAGAAAGAGGAAGG + Intronic
944276928 2:197849622-197849644 GGAGAAATGTAAAAGGAGAATGG + Intronic
944648785 2:201807820-201807842 GGGGAAAAGGAGCGGGTGAAAGG - Intronic
944993705 2:205269765-205269787 GGGGAAATGGATAAGCTAAAAGG + Intronic
946973693 2:225123427-225123449 GAGGAAATGAAGAAAGAGAAAGG - Intergenic
947120003 2:226803898-226803920 GGTTAAATGCAGAAGGTCAAGGG + Intergenic
947438963 2:230100628-230100650 GGGGAAGTGGAGATGGTTAATGG - Intergenic
947584946 2:231349453-231349475 GGGGAGTTGGAGAAGGTTAATGG + Intronic
948388934 2:237598314-237598336 GGGAAAATGGAGAAGGGGAGAGG - Intronic
948458843 2:238119521-238119543 GGGGAGATGGAGGAGGTGGATGG + Intronic
948878302 2:240841746-240841768 GGGAAACTTCAGAGGGTGAAAGG - Intergenic
1169318058 20:4609441-4609463 GGGGAAATAGAGAAGAAGAAAGG + Intergenic
1169380722 20:5104881-5104903 GGGGGAATGGGGAAGGTTAACGG + Intronic
1169531922 20:6494573-6494595 TGGGAAATACAGAAGGAGTAAGG + Intergenic
1169631379 20:7636495-7636517 AGGGAAATGAAGAAAGTGGAGGG + Intergenic
1171127985 20:22621270-22621292 GGGAAAATACAGAAGTTCAAAGG - Intergenic
1171236762 20:23533616-23533638 GGGGAAATGGAGCAGCTCAATGG - Intergenic
1171334871 20:24374580-24374602 GGGGGAATGTGGAATGTGAAAGG - Intergenic
1171480293 20:25450168-25450190 CGGGAAAAGGAGCAGGTGAAAGG + Intronic
1171492319 20:25529881-25529903 GGTAAAATTCAGAATGTGAAAGG + Intronic
1173515933 20:43665795-43665817 GGGGAAATGCAGAAGTCTACAGG + Intergenic
1173738401 20:45378075-45378097 GGAGAAAAGGAAAAGGTGAAGGG - Intronic
1173928204 20:46796741-46796763 AGGGAAAGGGAGAAGGAGAAGGG - Intergenic
1174554003 20:51381157-51381179 GAGGACAGGCAGAAGGGGAAAGG + Intergenic
1175111915 20:56654418-56654440 AGTGAGATGGAGAAGGTGAAAGG + Intergenic
1175387434 20:58606190-58606212 GGGGAGATGTGGGAGGTGAAGGG - Intergenic
1175813334 20:61870512-61870534 AGGGACATGCAGAAGGTGGAGGG - Intronic
1177584866 21:23078030-23078052 GGGGAGATGAAGATGGTTAATGG + Intergenic
1178150990 21:29793488-29793510 GGGGAAAAGGAAAAGGGGAAGGG - Intronic
1178478654 21:32959670-32959692 GAGGAAATGCAGAGAGTGCAGGG + Intergenic
1178595818 21:33951419-33951441 GGGGCAAAGCAGAAGGTGGGAGG + Intergenic
1179235561 21:39542437-39542459 GGGAAACTTCAGAGGGTGAAAGG - Intergenic
1179378416 21:40874841-40874863 GGGGAAAGGCAAAAGGGGAAAGG + Intergenic
1179452384 21:41475104-41475126 GGAGTAATTCAGAGGGTGAAGGG + Intronic
1179477769 21:41658887-41658909 GGGGAAAGGGAGAAGGAGACAGG + Intergenic
1179638418 21:42730490-42730512 GGGGAAATGCATAAGATAGAGGG + Intronic
1180039816 21:45270035-45270057 AAGGAAATGCAGAAGCTGACAGG + Intronic
1180044076 21:45294804-45294826 GCGGAAATGCAGACGGGGACGGG + Intergenic
1183239919 22:36650077-36650099 GGGCAAGTGCAGAAGCAGAAAGG - Intronic
1183281851 22:36936476-36936498 GGGGCAAGGCAGAGGGTGACGGG - Intronic
1183522039 22:38301034-38301056 GTGGAAAGGCAGAGGGAGAAAGG + Intronic
1184013544 22:41767895-41767917 GAGGAGATGGAGGAGGTGAAGGG + Intronic
1184061317 22:42083818-42083840 GAGAAAAAGCAGCAGGTGAAAGG - Exonic
1184362197 22:44025197-44025219 GTGGAAAGGCAGATGGAGAAAGG + Intronic
1184429114 22:44430894-44430916 GGTGAAATGTAGCAAGTGAAAGG + Intergenic
1184970937 22:48019400-48019422 GGGGCAGGGCAGAAGGAGAAAGG + Intergenic
1185043044 22:48515515-48515537 GAGGAACTGGAGAAGGGGAAAGG - Intronic
1185152495 22:49172463-49172485 GGGGGAATGCGAAATGTGAAGGG - Intergenic
949471402 3:4400550-4400572 GAGGCAATGCTGAAGGGGAAAGG + Intronic
950614135 3:14146011-14146033 GAAGAAAAGCAGAAGCTGAAGGG - Exonic
951577545 3:24129271-24129293 GGGGAAATGCAGAAACTCAGAGG - Intronic
952053250 3:29412352-29412374 AGAGAACTGCAGAAGGAGAAGGG + Intronic
952358877 3:32610214-32610236 GGGGAAAAACTGGAGGTGAAGGG - Intergenic
953633567 3:44642059-44642081 GGGGAAATGAAACAGATGAAAGG + Exonic
953884259 3:46706605-46706627 GGGGGAATGTAGGAGGTAAAGGG + Intronic
954944015 3:54401279-54401301 GGAGAATTGCAGAAGGATAAGGG + Intronic
955448624 3:59042276-59042298 GAGGAAATGCAGCAGGAGACGGG + Intronic
956071520 3:65457916-65457938 GGGGAAGTGGAGATGGTTAATGG - Intronic
956363765 3:68477024-68477046 GGGGGAATGAAGCAGTTGAAAGG - Intronic
956706211 3:72001315-72001337 AGGGAAATGGAGAAGATGCAGGG + Intergenic
957348113 3:78987625-78987647 GGGGAGGTGGAGATGGTGAATGG + Intronic
958068131 3:88571940-88571962 GGGGAAATGAAGATGGTTAATGG + Intergenic
958844516 3:99249975-99249997 GTGGAAATGGAGACGGTGAGAGG - Intergenic
959673108 3:109001905-109001927 TGGGAATTGTAGAAGGTGACTGG - Intronic
959689707 3:109185682-109185704 GGTGAAATGCAGGAGGGGAGAGG + Intergenic
960031056 3:113055523-113055545 GGGTAAATTCAGAAAGAGAATGG + Intergenic
960563004 3:119106329-119106351 GGGGAAATGGTGATGGTTAATGG - Intronic
961416554 3:126763180-126763202 GGGGAAAGGAAGAAGCAGAAAGG - Intronic
961509790 3:127393808-127393830 GAGGAAAAGCTGAAGGTGATAGG + Intergenic
962256900 3:133877230-133877252 AGGGAGATGCAGAAAGGGAATGG + Intronic
962262279 3:133919494-133919516 GCAGACATGCAGAAGGTGATTGG + Intergenic
962625201 3:137219240-137219262 GGGAAAATGTTGAAGGTGAGAGG + Intergenic
963007679 3:140741175-140741197 GGGGAAAGGAAAAAGGAGAATGG - Intergenic
963604436 3:147402417-147402439 GTGGAATTGCAGAAGGTCAGGGG + Intronic
963932456 3:151017785-151017807 GGGGAAAGACAGAAGGGGAAAGG - Intergenic
964349185 3:155786106-155786128 GGGGAAATGGGAAAGGAGAAAGG + Intronic
964713366 3:159695754-159695776 GGGAAAATGAAGAAGGTAAATGG - Intronic
965317052 3:167205246-167205268 TGGGAGATGCAGAGGGAGAAGGG + Intergenic
966285098 3:178286381-178286403 GGAGAAAAGTAGCAGGTGAAAGG - Intergenic
967153884 3:186674896-186674918 GGGAAAGTGCAGGTGGTGAAGGG - Intronic
967157456 3:186706393-186706415 GGGAAAGTGCAGGTGGTGAAGGG - Intergenic
967289031 3:187901431-187901453 GGGGATACTCTGAAGGTGAATGG + Intergenic
967433329 3:189415092-189415114 GCGTAAATGCCGAAGGTAAATGG + Intergenic
967772433 3:193348942-193348964 GGGGCAATCCAGGAGGTGAAGGG - Intronic
968378675 4:68871-68893 GGGGAAGTGGGGAAGGTTAATGG - Intronic
968678682 4:1900832-1900854 GGGGTCATGCAGAAGTTTAACGG + Exonic
969081769 4:4624640-4624662 CTGGGAAGGCAGAAGGTGAAAGG + Intergenic
969484536 4:7464840-7464862 TGAGAAATGCAGATGGGGAATGG + Intronic
969664646 4:8550053-8550075 GGTGGAAGGCAGAAGGTGAAAGG - Intergenic
970397403 4:15682255-15682277 AGGGAAATGCAAGAGGTGGAAGG + Intronic
970780784 4:19734991-19735013 GAGGAAAAGGAGAAAGTGAAAGG + Intergenic
971556302 4:28016396-28016418 AGTGAAAAGCAGCAGGTGAAAGG + Intergenic
972074896 4:35075216-35075238 GGGTAAATCCAGAGGGTTAATGG + Intergenic
972292689 4:37704609-37704631 GGTGGAAAGCAGAAGGTGTAGGG - Intergenic
972414597 4:38825894-38825916 TGGGGAATTCAGGAGGTGAAAGG - Exonic
972484191 4:39527016-39527038 GGGTAAAGGCAGAAAGAGAAGGG + Intronic
973718887 4:53703566-53703588 GGAGAAGTGCAGGAGGTCAAAGG - Intronic
974773796 4:66452662-66452684 GGAGAAGTGGAGATGGTGAATGG + Intergenic
975125274 4:70775264-70775286 GGGGAATTGTTGAAGGAGAAGGG + Intronic
975456369 4:74596261-74596283 GGTGGAAGGCAAAAGGTGAAAGG - Intergenic
976040677 4:80881101-80881123 GAGGAAAGGAAGAAAGTGAAGGG + Intronic
976929818 4:90552021-90552043 GGAGAAAGGCAGAAGGGAAAGGG + Intronic
977736143 4:100418517-100418539 GGGGAAGTGGAGATGGTTAATGG - Intronic
978673252 4:111277114-111277136 GGGGAAATGGGGATGGTTAATGG + Intergenic
978673418 4:111279176-111279198 GGGGAAAGGGAGATGGTTAATGG + Intergenic
978680607 4:111377113-111377135 AGGGAAAAGTAGAAGGTCAATGG - Intergenic
978723429 4:111942051-111942073 GGTGAAAGGCAGAAGGGCAATGG + Intergenic
979346796 4:119597128-119597150 GGGGAAATTCAAAAGATTAAAGG - Intronic
982132219 4:152239765-152239787 GGGAAAATGCTTAGGGTGAAGGG + Intergenic
982285852 4:153733678-153733700 GGAGAAATGCAGACTGTGCAAGG - Intronic
982521979 4:156429405-156429427 GGGTAAATGGAGCAGGGGAAAGG - Intergenic
982988212 4:162237089-162237111 GTGGAAATCAAGAAGATGAATGG + Intergenic
983046731 4:162996144-162996166 GGGCAACTGAAGAAGGTGAAGGG + Intergenic
983123347 4:163916463-163916485 GGGGAAAGGCACAAGTAGAAAGG + Intronic
984625443 4:182002382-182002404 GAGGAAATGGGGAAGGTGCAAGG - Intergenic
984702230 4:182825777-182825799 GGGGAAAGGGAGAAGGAGGAGGG - Intergenic
984911440 4:184676935-184676957 GGGGGAAGGGAGAAGGGGAAGGG - Intronic
985985596 5:3513461-3513483 CGGGAGAGGCAGAAGGAGAAGGG + Intergenic
986231313 5:5867044-5867066 GGGGAAAGGGAGAGGCTGAAAGG - Intergenic
986884758 5:12219786-12219808 GGGGAAGTGGAGATGGTTAATGG - Intergenic
987053279 5:14166256-14166278 GGGGACATGCAGAAGAAGACAGG - Intronic
987379571 5:17272439-17272461 GGGTAAAAGGAGAATGTGAATGG + Intronic
987853712 5:23390550-23390572 GCTGGAGTGCAGAAGGTGAAGGG - Intergenic
988972089 5:36478856-36478878 GGGGAAATGCTTAAGGGGAATGG + Intergenic
989451029 5:41586962-41586984 GGAGAAGTGCAGAGGGAGAAGGG + Intergenic
990395879 5:55377822-55377844 GAGAAAAAGCAGCAGGTGAAAGG - Intronic
991285385 5:64969515-64969537 GGGGAAAATAAGAAGGTGTAGGG - Intronic
992307138 5:75452877-75452899 GGAGAAATGCAGAATATTAATGG + Intronic
992343849 5:75855918-75855940 GGAGAAATGGAGATGGTTAATGG - Intergenic
992871193 5:81007193-81007215 GGAAACCTGCAGAAGGTGAAGGG + Intronic
993307396 5:86289674-86289696 GGAGAAATGCAAAATGGGAAAGG - Intergenic
993730930 5:91421888-91421910 GGAGAAAGGCAGAAGGGGAGAGG + Intergenic
994541024 5:101097391-101097413 GGGGAGATGCAGATGGTTAATGG + Intergenic
994985535 5:106928424-106928446 GGGGAAATGCAGAAAGAGCTGGG + Intergenic
995155835 5:108912086-108912108 GGTGGAAGGCAGAAGGCGAAAGG - Intronic
995483251 5:112613977-112613999 AGTGAAAAGCAGAAGGGGAATGG + Intergenic
996075242 5:119185212-119185234 GGGAAAGGGCAGAAGGAGAAGGG - Intronic
997163213 5:131631587-131631609 GGGCAAAAGCAGGAGGTTAACGG - Intronic
998127829 5:139636135-139636157 GGGGAAATGGAGAAATGGAAAGG + Intergenic
998359582 5:141573650-141573672 CGGGAAATGGAGGAGGTGGAGGG + Exonic
998478337 5:142440336-142440358 GTGGTAATGCAGTAGGTGACAGG - Intergenic
998604397 5:143618778-143618800 TGGGAAATGAAGAGGGTGATGGG + Intergenic
998875560 5:146595390-146595412 GACAAAATGCCGAAGGTGAATGG - Intronic
998904462 5:146889549-146889571 GGGGTAATGCATGAGGTCAATGG + Intronic
999068544 5:148717497-148717519 CAGGAGAGGCAGAAGGTGAAGGG - Intergenic
999455298 5:151710696-151710718 GGGGAAGTGGAGATGGTTAACGG - Intergenic
999525731 5:152404284-152404306 GGGGAAATTCAGAAATGGAAGGG - Intronic
1000049863 5:157553054-157553076 GGGGAGATGCAGATAGTTAATGG + Intronic
1000811937 5:165874202-165874224 GGGGAAATGGAGAAGCTGAAAGG + Intergenic
1001021174 5:168183583-168183605 ATGGAAATGAAGAAGGTGCAGGG - Intronic
1001423538 5:171606191-171606213 GAGTAAATGCAGAAGGTAAGAGG - Intergenic
1001762550 5:174220289-174220311 GGGGACTTGCAGGAGCTGAAGGG + Intronic
1001929592 5:175663575-175663597 GGAGAAATGCAGACAGTGCACGG - Intronic
1002083134 5:176749210-176749232 TGGGACATGTAGAAGGTGACAGG + Intergenic
1002573963 5:180161225-180161247 GGGGAGAGGAAGAAGGTGCAGGG + Intronic
1003502970 6:6717321-6717343 GGGGAAATACAAAAGGGCAAGGG + Intergenic
1003637519 6:7846510-7846532 GGGGAAACACAGAAGGAGGAAGG + Intronic
1004320166 6:14625899-14625921 GGGGAGAGGAAGAAGGAGAAGGG + Intergenic
1004645655 6:17558429-17558451 GCGGCAAAGCAGAAGATGAAGGG + Intergenic
1004869529 6:19890730-19890752 GAGGAAAAGAAGAAGGAGAAAGG - Intergenic
1005639882 6:27785880-27785902 GTGGAGATGCAGCAGGTTAAGGG - Intergenic
1005911676 6:30315622-30315644 TGGGAAATGAAGAAGGCCAAGGG + Intergenic
1006025748 6:31145584-31145606 GGTGAAAGGAGGAAGGTGAATGG + Intronic
1006097528 6:31665442-31665464 GGGGAAATGGAGAAGTGCAAAGG + Intronic
1006461989 6:34164968-34164990 GGGGAAGTGGAGATGGTTAATGG - Intergenic
1007706497 6:43794452-43794474 AGGGAAATGCAGATGGTTATAGG + Intergenic
1008154995 6:48002842-48002864 GGGGGAATGCTGAAAATGAAAGG - Intronic
1009197802 6:60708284-60708306 GATGAAATGAAGAAGGTGAGAGG + Intergenic
1009818767 6:68772313-68772335 AGGGAAATACAGAAGATGGATGG + Intronic
1010083302 6:71887476-71887498 TGGGAAGTGCAGAAGCTGAGAGG + Intronic
1010139688 6:72600247-72600269 GGGGAAGTGAAGATGGTGAATGG - Intergenic
1010177654 6:73048403-73048425 GGAGAATAGCAGAAGGTGATAGG + Intronic
1010238245 6:73592633-73592655 GAGAAAAAGCAGCAGGTGAAAGG + Intergenic
1010346157 6:74813458-74813480 GGGGCATATCAGAAGGTGAAGGG + Intergenic
1011078931 6:83467943-83467965 GGGGAACTGCACATGGTGAGTGG - Intergenic
1011832155 6:91387183-91387205 GGGGTAAAGAAGAAGGAGAACGG + Intergenic
1012051948 6:94357880-94357902 GAGGAAATGGAGAAGGAAAAAGG - Intergenic
1012248144 6:96949821-96949843 AGGGAAATTCAGTAGGTAAATGG + Intronic
1012345526 6:98180696-98180718 GGGTAAATGCAAAAGCTAAAGGG - Intergenic
1012351821 6:98260822-98260844 GGGCATATGCAGAAGGAGAGAGG + Intergenic
1012724081 6:102786044-102786066 GACAAAAAGCAGAAGGTGAATGG - Intergenic
1012909953 6:105107068-105107090 GGGGAAGTGGAGATGGTTAATGG - Intronic
1012912341 6:105132447-105132469 GGGGACACGGAGAAGGTGATAGG - Intronic
1013105245 6:107021570-107021592 GTGGAATAGCAGAAAGTGAATGG + Intergenic
1013385469 6:109625473-109625495 GGGGCACTGCAGGAGGTGAGCGG + Intronic
1013562493 6:111319528-111319550 GGGGAAGTGGAGATGGTTAATGG + Intronic
1016401348 6:143684275-143684297 GGTGAAATGTAGAAAGTCAAGGG - Intronic
1016401727 6:143688552-143688574 GGTGAAATGTAGAAAGTCAAGGG - Intronic
1016583833 6:145661211-145661233 GGTGAACTGCAGATTGTGAAAGG - Intronic
1016765794 6:147792100-147792122 GGTGGAATGCAGAATGAGAAAGG + Intergenic
1016844515 6:148557812-148557834 GGTTGAATGCAGAATGTGAAAGG - Intergenic
1017396701 6:154008792-154008814 GGGGAAGTGGAGATGGTTAATGG + Intergenic
1018356727 6:163025603-163025625 AGGAAAATGCAGAAGGAGATTGG + Intronic
1018391748 6:163346345-163346367 GGGGTATTTCTGAAGGTGAAGGG - Intergenic
1018884909 6:167927164-167927186 GGAGAAATTAAGAAGATGAATGG + Intronic
1019486327 7:1291069-1291091 GGGGGGATGCAGAAGGGGATGGG - Intergenic
1020418676 7:7974505-7974527 GGGGAAATGTTGAAGGATAATGG + Intronic
1020517793 7:9145750-9145772 GGTGAAATGCAGAAGGATCAGGG - Intergenic
1020969778 7:14921320-14921342 GGCAAAATGGAGAAGGAGAAGGG + Intronic
1021158857 7:17246846-17246868 GAGAAAAAGGAGAAGGTGAAAGG - Intergenic
1022056642 7:26742428-26742450 GGGGAAAAGGAAAAGGAGAAGGG + Intronic
1022521908 7:31013861-31013883 GGTGGGATGCATAAGGTGAATGG - Intergenic
1023037350 7:36143820-36143842 GAGGAAATGAATAAAGTGAATGG + Intergenic
1023919716 7:44618695-44618717 GAGAAAAAGCAGCAGGTGAAAGG - Intronic
1024295993 7:47842748-47842770 GAGCAGCTGCAGAAGGTGAAGGG + Intronic
1024656764 7:51457659-51457681 TGGGAATTGCAGAAACTGAAGGG - Intergenic
1025872480 7:65447950-65447972 GGAGAAATTCAGCAGGTTAAGGG + Intergenic
1026165741 7:67907701-67907723 GCGGAGATGCATAAGGGGAAAGG + Intergenic
1026307420 7:69154137-69154159 GGTGGAAGGCAGAAGGTGAAAGG + Intergenic
1026518534 7:71094431-71094453 GGAGAGATGGAGAAGGTGAGGGG + Intergenic
1026678351 7:72446940-72446962 GAGGAAAAGCAGAAGGGGGAAGG + Intronic
1026900137 7:74032541-74032563 GAGGAAATGGAGAAGGTTTAGGG - Intronic
1026946775 7:74321272-74321294 GGGGGAAGGGAGAAGGTTAAAGG - Intronic
1027235453 7:76295063-76295085 TGGGCAATGAAGAAGGGGAAGGG + Intergenic
1027367821 7:77476897-77476919 GGGGAAATGGAGATGGTTAATGG - Intergenic
1028857574 7:95608901-95608923 GGGGAAGTTTAGTAGGTGAAGGG + Intergenic
1029977510 7:104848642-104848664 AGGGAAAAGGAGAAGGGGAAAGG + Intronic
1030244173 7:107362661-107362683 TGGGAAATGAAACAGGTGAAAGG + Intronic
1030767742 7:113432467-113432489 AGAGAGATGCAGAAGGTGGAGGG - Intergenic
1031020368 7:116621066-116621088 GGTGAAATTCAAAAGGGGAAGGG - Intergenic
1031257072 7:119466802-119466824 GAGGAAGTGCAGAAGGGAAAGGG + Intergenic
1031741258 7:125434391-125434413 GGGGAAAAATAGAAGGAGAAAGG - Intergenic
1032640369 7:133759754-133759776 AGGGAAAAGAAGAAGGAGAAAGG + Intronic
1033451983 7:141470485-141470507 GGGGAAATGGAGAAGGAAAGGGG - Intronic
1033619988 7:143053241-143053263 GGGCAGATGCAGAGGCTGAAAGG + Exonic
1034416122 7:150965129-150965151 TGGGAAATGCAGCAGGTTGAGGG + Intronic
1035754718 8:2022753-2022775 GGGGAAATGGAGAAAGGGAGAGG - Intergenic
1037076274 8:14723217-14723239 GAGAAAATGCAGAATGTGAATGG + Intronic
1037497912 8:19458339-19458361 GGGGAAATGAAGGAGATGACGGG + Intronic
1037584767 8:20268828-20268850 ATGGAAAGGCAGAAAGTGAAAGG + Intronic
1037745711 8:21642567-21642589 AGAGAAAAGCAGGAGGTGAAAGG + Intergenic
1038267612 8:26048410-26048432 GGGTAAATGAAGAAGGGGACAGG - Intergenic
1039094854 8:33872467-33872489 GGGGAAAGGAAGAAGGTGGGAGG + Intergenic
1040459661 8:47635048-47635070 GGGGAAAGGGAGATGGTTAATGG + Intronic
1040483453 8:47848471-47848493 GGGGAACAGAAGAAGGGGAAGGG + Intronic
1040985386 8:53288403-53288425 AGGAATATGCAGAAGGAGAAAGG - Intergenic
1041082237 8:54224868-54224890 GGTGAAATTCAGACTGTGAAGGG - Intergenic
1041207242 8:55511425-55511447 GGGGGAAGGCAGAAGGTAGAGGG - Intronic
1041578785 8:59432599-59432621 GGGGACATGGAGATGGTTAATGG - Intergenic
1041626740 8:60037819-60037841 GGGCAGATGAAGAAGGTTAATGG + Intergenic
1042501776 8:69516295-69516317 GCAGAATGGCAGAAGGTGAAGGG + Intronic
1043559472 8:81473995-81474017 GGGGAATTTCAGAGGGTGGAGGG + Intergenic
1043689185 8:83129192-83129214 GTGGAAATGTAGAAGTTGCAAGG + Intergenic
1044113213 8:88302647-88302669 TTGGAAATGCAGAAGTGGAAGGG + Intronic
1044122115 8:88410841-88410863 GAGGAAACACAGAAGGTGGATGG + Intergenic
1044152697 8:88800980-88801002 AGGGCAATGCAGAGGGGGAAGGG + Intergenic
1044370950 8:91410042-91410064 GTGGATATGCAGTAGGTTAATGG - Intergenic
1044374033 8:91448399-91448421 GGGAGAATGGAGAAGGAGAAGGG - Intergenic
1044719606 8:95133388-95133410 GGGGAACTGAAGAACGAGAAAGG - Intergenic
1045270288 8:100655566-100655588 GGCAGAATGCAGAAGCTGAAAGG - Intronic
1046235503 8:111419337-111419359 TGGGAATTGCAGAAGGCAAATGG - Intergenic
1046612909 8:116445311-116445333 GGGGAGGGGCAGAAGGTGGAGGG + Intergenic
1046659122 8:116929523-116929545 GGGAACCTTCAGAAGGTGAACGG + Intergenic
1046968718 8:120196007-120196029 GGGGAAATGCAGAAGGTGAATGG - Intronic
1047194937 8:122712772-122712794 AGGGCAATGCAGAAGGGAAATGG + Intergenic
1047203695 8:122786700-122786722 GGGGGGAGGCAGAAGGGGAATGG - Intronic
1047341660 8:123986631-123986653 GGAGAAGTGCAGATGGTTAATGG - Intronic
1048571791 8:135662946-135662968 GCAGAACTGCAGGAGGTGAAGGG - Intergenic
1049231511 8:141487224-141487246 GGGGAAATGGAGATGGTTAATGG - Intergenic
1049452943 8:142672119-142672141 GGGGCAATGCAGATGGAGCAAGG - Intronic
1050569744 9:6925413-6925435 GGGGAAAGGAGGAAGGGGAAAGG - Intronic
1051759077 9:20440478-20440500 GGGGAAATTGAGGAGGAGAACGG - Intronic
1052840784 9:33289605-33289627 GGGGAAAGGTGGAGGGTGAACGG - Intergenic
1053153346 9:35756765-35756787 GGGGTGATGCCGAAGGGGAAGGG + Exonic
1053364837 9:37515449-37515471 GCTGAAATGGAGAACGTGAAAGG + Intronic
1055347337 9:75352716-75352738 AGGGACATTGAGAAGGTGAAAGG + Intergenic
1055370606 9:75594143-75594165 GGGAAACTGCAGAAGGTGCTAGG - Intergenic
1055552809 9:77446640-77446662 GGGGAGATGCTCAAGGTGATGGG + Intronic
1056123305 9:83510853-83510875 GGGGAAATGAAGAGGGTGGAGGG + Intronic
1057015329 9:91645862-91645884 GGGGAAAGGGAGAGGGTGACAGG - Intronic
1057861651 9:98645490-98645512 GAGGAAAGGCTGAAGGTGCAGGG - Intronic
1058572295 9:106359524-106359546 CAGGAAATTCAGAAAGTGAAAGG - Intergenic
1058936880 9:109777996-109778018 GGGGAGATGGAGAAGGAAAAGGG - Intronic
1059557884 9:115299742-115299764 GTGGCAGTGCAGAAGGGGAAAGG + Intronic
1061656790 9:132098047-132098069 GAGGAAAGGGAGAAGGTGGATGG + Intergenic
1185716521 X:2347202-2347224 GGTGGAAAGCAAAAGGTGAAAGG + Intronic
1186039576 X:5461130-5461152 GGGAAACTTCAGAGGGTGAAGGG + Intergenic
1186927547 X:14351889-14351911 GTGGAAATGCAGAAGCAGGAGGG + Intergenic
1186929743 X:14375490-14375512 GGGGAAGTGGAGATGGTTAATGG + Intergenic
1187030534 X:15483513-15483535 GAGTAAATACAGAAGGTGAGAGG - Intronic
1187367907 X:18679617-18679639 GGGAAAGGGCAGAAGCTGAAAGG - Intronic
1188089189 X:25941295-25941317 GATGAAATGCAGAAGGTGGATGG + Intergenic
1188315891 X:28672955-28672977 GGGGCATTTCAGAAGGTGGAGGG - Intronic
1188489624 X:30723580-30723602 GGGGAAATTCAGCAGGGTAAAGG - Intronic
1189606186 X:42680650-42680672 GGGGAAAAGAAAAAAGTGAATGG - Intergenic
1189969425 X:46402904-46402926 GGGGAAAAGCATAAGGGGATAGG - Intergenic
1190288861 X:48978553-48978575 GGGGAAAGGCAGAAGCAGACAGG + Intronic
1190569590 X:51768134-51768156 GGGGACATGCATAGGGTGAGTGG + Intergenic
1190950825 X:55141095-55141117 GGGGAATGGCAGAAAGGGAATGG - Intronic
1192172360 X:68864999-68865021 GGGGAAGAGCAGAGGGAGAAGGG + Intergenic
1192343263 X:70281276-70281298 GGGGGGATGCAGAAAGGGAAAGG - Intronic
1192676553 X:73202802-73202824 AGGGCAATGCAGAAGGGAAATGG - Intergenic
1192868704 X:75164257-75164279 GTTGGAAAGCAGAAGGTGAAAGG - Intergenic
1193151651 X:78131032-78131054 GGGGAGGTGCAGAAAATGAATGG + Exonic
1193742807 X:85238581-85238603 GGGGAAATGGGGATAGTGAATGG + Intergenic
1194241754 X:91457649-91457671 GGGTAAATGCAAAATCTGAATGG - Intergenic
1194494682 X:94599912-94599934 CAGGAAATGCACAAGGGGAAAGG + Intergenic
1194559899 X:95407237-95407259 GGGTAAGTGCAGATGGTTAATGG + Intergenic
1194757194 X:97750992-97751014 TTGGAAATGTAGGAGGTGAATGG - Intergenic
1195022044 X:100838620-100838642 ACAGAAATGTAGAAGGTGAAAGG + Intronic
1196867515 X:120083456-120083478 GTGGCAATGCAGGAGGTGCAAGG - Intergenic
1196875586 X:120152825-120152847 GTGGCAATGCAGGAGGTGCAAGG + Intergenic
1197282513 X:124553553-124553575 GGGGAATTGGAGATGGTTAATGG - Intronic
1197729857 X:129800356-129800378 GGGGGAGTGAAGAAAGTGAAGGG + Intergenic
1197759233 X:130015917-130015939 GTGAAAATGGAGAAGGTGGATGG + Exonic
1197775114 X:130113823-130113845 AGGGAAGTGCAGATGGTTAATGG - Intergenic
1198160721 X:134005221-134005243 GGAGAAATTCAGCAGGTTAAGGG - Intergenic
1198585898 X:138121998-138122020 GGGGAGGTGCAGATGGTTAATGG - Intergenic
1198977019 X:142347568-142347590 TGGCAAATGCTGAATGTGAAAGG - Intergenic
1199619730 X:149688372-149688394 GAGAAAAAGAAGAAGGTGAAAGG + Intronic
1200097449 X:153670834-153670856 GGGGAAAGGCTGAAGGTCAGGGG + Intronic
1200230228 X:154440252-154440274 GGGGAAATGGAAAGGGTGATAGG - Intronic
1200302797 X:154995326-154995348 GGGGAAATGTAGCAGTAGAATGG + Intronic
1200379998 X:155826113-155826135 GGGGAAATGAGGATGGTTAATGG + Intergenic
1200909615 Y:8518109-8518131 GGGGAAATACCTAATGTGAATGG + Intergenic
1202139028 Y:21701674-21701696 AGGAAAAAGCAGAAGCTGAAGGG - Intergenic