ID: 1046969250

View in Genome Browser
Species Human (GRCh38)
Location 8:120203302-120203324
Sequence CAGGTCCACCAGAAGTGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046969243_1046969250 19 Left 1046969243 8:120203260-120203282 CCTCTTTAAAGTGGCAGATGCTT 0: 1
1: 0
2: 0
3: 9
4: 170
Right 1046969250 8:120203302-120203324 CAGGTCCACCAGAAGTGGGGAGG No data
1046969245_1046969250 -8 Left 1046969245 8:120203287-120203309 CCAAATCCAAGACTGCAGGTCCA 0: 1
1: 0
2: 2
3: 14
4: 136
Right 1046969250 8:120203302-120203324 CAGGTCCACCAGAAGTGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046969250 Original CRISPR CAGGTCCACCAGAAGTGGGG AGG Intronic
No off target data available for this crispr