ID: 1046970013

View in Genome Browser
Species Human (GRCh38)
Location 8:120212464-120212486
Sequence ACTCAATTCAATATCTGTGT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 126}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046970013_1046970019 27 Left 1046970013 8:120212464-120212486 CCCACACAGATATTGAATTGAGT 0: 1
1: 0
2: 2
3: 7
4: 126
Right 1046970019 8:120212514-120212536 GTCACAGTTTATGCCATGTTTGG 0: 1
1: 0
2: 0
3: 7
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046970013 Original CRISPR ACTCAATTCAATATCTGTGT GGG (reversed) Exonic
905544897 1:38789990-38790012 ACTCAATCCAAAATCTATGTGGG - Intergenic
907140261 1:52179856-52179878 ACTCCATTCAGTGTCTGCGTTGG - Intronic
908602362 1:65754526-65754548 GCTCAATTAAATATCTGTGTTGG - Intergenic
909149940 1:71988686-71988708 ACTCAGTTAAATACATGTGTAGG + Intronic
910480437 1:87652996-87653018 ACAGAATTCAATATCTGGGGAGG - Intergenic
910685512 1:89912132-89912154 ACTCAATTCAATTTTTCAGTTGG - Intronic
911249149 1:95555394-95555416 GCTTAATTAAATATCTTTGTAGG + Intergenic
912101232 1:106208525-106208547 ACTCATTTTAATTGCTGTGTGGG - Intergenic
914792615 1:150891819-150891841 CCTCAATTCAATTCATGTGTTGG + Intergenic
917332729 1:173898741-173898763 ACTCAATTTATTTTCTGTTTGGG + Exonic
921353734 1:214264455-214264477 ACTCAATTGAATGCCTGTGGTGG - Intergenic
921478561 1:215637440-215637462 AGTCAATAGAAAATCTGTGTTGG + Intronic
1065318191 10:24484919-24484941 TCACAATTCACTTTCTGTGTAGG - Intronic
1066572464 10:36788281-36788303 GCTCAATTCACTTTCTGTGCTGG - Intergenic
1075821774 10:125319788-125319810 AGTCAATTGAATATCCATGTGGG - Intergenic
1080144759 11:28968298-28968320 ACTCCAATCAATATGTCTGTGGG - Intergenic
1080477910 11:32614024-32614046 AGTCAATTTAATAACTGTTTGGG - Exonic
1082685725 11:56236735-56236757 ACTCAATTCAATCTCCTTGAAGG - Intergenic
1085145776 11:74195249-74195271 ATGCAATTCAATACCAGTGTGGG - Intronic
1087360340 11:97150662-97150684 ACTAGATTCATTTTCTGTGTTGG + Intergenic
1087604271 11:100357094-100357116 ACCTAATTCAACATCTGTTTTGG - Exonic
1087772919 11:102229954-102229976 ACTGAATTCTAAATCTGTGAAGG + Exonic
1088192659 11:107242783-107242805 ACTCAATTCAATATGTTTGAGGG + Intergenic
1089927642 11:122275544-122275566 AGTCAATTCAGGCTCTGTGTGGG - Intergenic
1092289745 12:7152621-7152643 ACTTATTTCAATATATGTGATGG + Intronic
1093400594 12:18742003-18742025 ACCAAATTAAATATCTTTGTGGG - Intergenic
1097660354 12:62423523-62423545 CCTCACTTGAATATCTGTTTTGG - Intergenic
1099831743 12:87852428-87852450 TCTCACTTAAATATGTGTGTAGG + Intergenic
1100101749 12:91115918-91115940 TCTCAATTAAATATTTATGTAGG - Intergenic
1100438917 12:94597470-94597492 ACTCAATCCATTATTTGTGATGG + Intronic
1101720259 12:107344820-107344842 ACTTAATTTAATATTTCTGTAGG + Intronic
1105715892 13:23064698-23064720 ACTCAATTAAACATCTGTTAAGG + Intergenic
1110879340 13:80552295-80552317 ACTCATTTGACCATCTGTGTAGG + Intergenic
1112191027 13:97177457-97177479 ACACAAATCAATAACTCTGTAGG + Intergenic
1114724092 14:24916050-24916072 ACTCAAATAAATATATGTCTTGG + Intronic
1121429818 14:93878937-93878959 ACTAAACTCAAGATCTGTCTTGG + Intergenic
1123899006 15:24857829-24857851 ACTCAAATCAATCTCCCTGTAGG + Intronic
1124266389 15:28238373-28238395 ACTCATTTCAAGTTCTGAGTTGG - Intronic
1124932913 15:34139999-34140021 AATCAATTCAATAACTGAGAGGG + Intergenic
1127314687 15:57783828-57783850 ACACATCTCAATATCTGTGTAGG + Intergenic
1129641733 15:77386454-77386476 CATAAATTCAATATCTGTTTAGG + Intronic
1130178520 15:81600736-81600758 GCTCTTTTCAAAATCTGTGTTGG - Intergenic
1131534570 15:93224700-93224722 ACTCAATTTAAAATCTTAGTAGG - Intergenic
1132991136 16:2794893-2794915 ACTCAAATCAATCTCTCTGAAGG - Intergenic
1134394001 16:13845769-13845791 ACTCAATTAAAGAAATGTGTTGG + Intergenic
1136704584 16:32175786-32175808 ACTCATTTCAAGTTCTGAGTTGG - Intergenic
1136763329 16:32753620-32753642 ACTCATTTCAAGTTCTGAGTTGG + Intergenic
1136804771 16:33116766-33116788 ACTCATTTCAAGTTCTGAGTTGG - Intergenic
1138626425 16:58255522-58255544 ACTCAATTCACTGACTGTGATGG - Intronic
1138879350 16:60991857-60991879 AAGCAATTCAATATATGTGCTGG - Intergenic
1141309040 16:82895292-82895314 ACACAATTGAGTATATGTGTGGG - Intronic
1203065479 16_KI270728v1_random:1013941-1013963 ACTCATTTCAAGTTCTGAGTTGG + Intergenic
1145290740 17:21543788-21543810 ACTCAATTCATTATGTGTTTTGG - Intronic
1147284044 17:39386835-39386857 ATTCAATGCAATATCAGTCTGGG - Intronic
1164261448 19:23571514-23571536 ACTCAACTCAGTGTATGTGTGGG + Intronic
929075953 2:38078846-38078868 ACTCATTTCAAAGGCTGTGTAGG - Intronic
931290882 2:60872353-60872375 TCTCAATTCAATACCTGTGTAGG - Intergenic
931707641 2:64960538-64960560 ACTCGCCTCAATATCTGTGTGGG - Intergenic
933023661 2:77225519-77225541 ACTCAATTTAATATTTATGGAGG - Intronic
935163042 2:100545876-100545898 TCTCAATTCAATGTCTCTCTGGG + Intergenic
935914336 2:107933120-107933142 AGAAAACTCAATATCTGTGTAGG - Intergenic
936341487 2:111637393-111637415 ATTCAATCCAGTATCTATGTGGG + Intergenic
936756670 2:115722127-115722149 ACTCAACTGAAATTCTGTGTCGG - Intronic
936829159 2:116620668-116620690 GCTCACTTCAATATCTTTCTTGG - Intergenic
939238202 2:139524625-139524647 ACTCACTGCAGTATCTGAGTAGG + Intergenic
939703205 2:145420054-145420076 ACACAATTCAAAATCTGGCTGGG + Intergenic
941410504 2:165150756-165150778 AATAAACTCATTATCTGTGTAGG + Intronic
942318564 2:174716334-174716356 TTTCAAGTCAATATTTGTGTTGG + Intergenic
943085251 2:183303095-183303117 AATCAATTCGATATCTATATGGG + Intergenic
1173461395 20:43246138-43246160 ACTCAGTTCAAAAACTGTGCAGG + Intergenic
1177075536 21:16567459-16567481 ACTAAATTCAATCTATGTTTTGG - Intergenic
1177471599 21:21566864-21566886 GCTCAATTTAATTTCTGTGCAGG - Intergenic
950643341 3:14362354-14362376 GGTTAATTCCATATCTGTGTGGG - Intergenic
952650251 3:35717845-35717867 ACTTAAATTAAAATCTGTGTAGG + Intronic
954178803 3:48865419-48865441 ACTCAAATTTATATCTCTGTGGG - Intronic
956603566 3:71049408-71049430 AGTCACTTCAATAGCTGTATTGG + Intronic
959355356 3:105320898-105320920 ATTCAATTCTATATCTGCCTGGG - Intergenic
960488884 3:118285498-118285520 GCTCAATTCATCATCTGGGTTGG - Intergenic
962446589 3:135471359-135471381 ACTCTGAGCAATATCTGTGTTGG - Intergenic
964554432 3:157920440-157920462 ACTCAATTGGTTAGCTGTGTTGG - Intergenic
965789536 3:172372844-172372866 AGTCAATGCAATATTTATGTTGG - Intronic
965826284 3:172734222-172734244 ACTCAATTAAATATTTCTATGGG + Intergenic
969085722 4:4655013-4655035 AGTCAATTGAATGTCTATGTGGG - Intergenic
969498260 4:7538550-7538572 ACTCCATTATATATCAGTGTTGG + Intronic
970058836 4:12006199-12006221 ACTCAATGAAATGTGTGTGTAGG - Intergenic
971991008 4:33893716-33893738 TCTCAAATCAATATCTATGAAGG + Intergenic
975265110 4:72354309-72354331 ACTCAAGTCAGTATCTGTAAAGG - Intronic
976411913 4:84723141-84723163 ACCCAATTCAATAACTATGCTGG + Intronic
977142964 4:93398700-93398722 ACCATATTCAATATCTGTGCAGG - Intronic
977833591 4:101620907-101620929 ACTCAATTGAATATATTTTTTGG + Intronic
978768566 4:112430406-112430428 TTTCAATTCAATATCTGATTTGG + Intronic
980233448 4:130073362-130073384 ACTCAATTTGCTATCTGTGCTGG + Intergenic
980276445 4:130657244-130657266 ACTCAATTCAACAAATGTATTGG + Intergenic
980819758 4:137998584-137998606 ACTTAATTTAATTTCTGTGTTGG + Intergenic
981428330 4:144630443-144630465 AATTAATTCGATAGCTGTGTAGG + Intergenic
984861160 4:184240600-184240622 AATCAATTGAATATATGTATAGG - Intergenic
988235059 5:28531941-28531963 ACCCTTTTCAATATCTATGTTGG - Intergenic
990427153 5:55697631-55697653 ACTAAACTCAACATCTCTGTTGG - Intronic
990929324 5:61070110-61070132 ATTTAATCCAATATATGTGTAGG - Intronic
992638178 5:78745749-78745771 ATTGACTTCAATCTCTGTGTAGG - Intronic
993577240 5:89617306-89617328 ACTCAATTCTATAGCTGGGGTGG - Intergenic
994338188 5:98594358-98594380 GGTCAATTCAGTATCTGTATGGG - Intergenic
994890658 5:105630582-105630604 ACTGAATTGAATAGATGTGTGGG - Intergenic
997538701 5:134643089-134643111 ACTCAATTCAACATGTGGGATGG + Intronic
1004950232 6:20661880-20661902 ACATAATTAAATATATGTGTTGG + Intronic
1007952990 6:45888825-45888847 ACAGAATTATATATCTGTGTTGG - Intergenic
1010836256 6:80590566-80590588 ACACAATTAATTATCTGTGGGGG + Intergenic
1014317728 6:119888419-119888441 ACACCATTGAATATCTGTGGAGG + Intergenic
1015176478 6:130314633-130314655 ATTCAATTCAATATCCTTTTTGG - Intronic
1021071037 7:16241297-16241319 ACTCAATTCAATACTTTTGAAGG + Intronic
1027871189 7:83710437-83710459 ACTCAAATCAATCTCTCTGAAGG + Intergenic
1029271395 7:99379132-99379154 ACTCAATTCAACAAGTGGGTGGG - Intronic
1030507471 7:110443053-110443075 ACCCAATTAAATATATTTGTGGG + Intergenic
1033295173 7:140126305-140126327 CCTGAATTAAATATCTGTGAAGG - Intronic
1037331512 8:17748050-17748072 ACTCAATACAAGATTTGGGTGGG + Intronic
1039767429 8:40644407-40644429 ACTCAAATCACTGTGTGTGTGGG - Intronic
1043671723 8:82894609-82894631 ATTCCATTGAATATCAGTGTTGG - Intergenic
1043733756 8:83718670-83718692 TTTCAATTCAATATCTGGGGTGG - Intergenic
1043823499 8:84897048-84897070 ATTCAATTCCATTTCTATGTAGG - Intronic
1043832457 8:85006066-85006088 ACCCTATTCAACAACTGTGTTGG + Intergenic
1044811314 8:96065566-96065588 ACTCAATGCATTTTCTGTCTTGG - Intergenic
1046970013 8:120212464-120212486 ACTCAATTCAATATCTGTGTGGG - Exonic
1050518096 9:6466823-6466845 AGTCAAATGAGTATCTGTGTAGG - Intronic
1050918837 9:11173022-11173044 ATTCAATTGAAAATCTCTGTGGG - Intergenic
1052580822 9:30351377-30351399 AATAAATTCAATAAATGTGTAGG - Intergenic
1058322315 9:103648885-103648907 ACTCAATTGAATATGTGTGCAGG - Intergenic
1059004824 9:110390749-110390771 AATTAATTCAATATTTCTGTGGG - Intronic
1186016038 X:5195242-5195264 ACCTAATTCATGATCTGTGTAGG + Intergenic
1186346214 X:8695851-8695873 ACTCAGTTCAAATCCTGTGTAGG + Intronic
1188895062 X:35657519-35657541 ACTCATTTTAATATTTGTATAGG + Intergenic
1189666686 X:43362914-43362936 ACTGAATTCAATATATTTCTAGG + Intergenic
1191702407 X:64057416-64057438 AATAAATTCAATATCTATTTAGG - Intergenic
1195130391 X:101845238-101845260 ACTCACTACTATGTCTGTGTGGG - Intronic
1196417302 X:115485012-115485034 ACTCAATTCATTGTCTCAGTAGG - Intergenic
1197167757 X:123396666-123396688 TTTCCATTCAATATATGTGTAGG - Intronic
1197305219 X:124833301-124833323 ACTCAACTCATTATCTTTCTGGG - Intronic