ID: 1046974737

View in Genome Browser
Species Human (GRCh38)
Location 8:120261854-120261876
Sequence CAATTGCAAAAGACATTCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 168}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046974737_1046974744 28 Left 1046974737 8:120261854-120261876 CCTGGGAATGTCTTTTGCAATTG 0: 1
1: 0
2: 0
3: 7
4: 168
Right 1046974744 8:120261905-120261927 CAAGGCTGAGAGGGAGATACTGG No data
1046974737_1046974742 18 Left 1046974737 8:120261854-120261876 CCTGGGAATGTCTTTTGCAATTG 0: 1
1: 0
2: 0
3: 7
4: 168
Right 1046974742 8:120261895-120261917 AGTTAAAAGTCAAGGCTGAGAGG No data
1046974737_1046974745 29 Left 1046974737 8:120261854-120261876 CCTGGGAATGTCTTTTGCAATTG 0: 1
1: 0
2: 0
3: 7
4: 168
Right 1046974745 8:120261906-120261928 AAGGCTGAGAGGGAGATACTGGG No data
1046974737_1046974741 10 Left 1046974737 8:120261854-120261876 CCTGGGAATGTCTTTTGCAATTG 0: 1
1: 0
2: 0
3: 7
4: 168
Right 1046974741 8:120261887-120261909 CTGGTATCAGTTAAAAGTCAAGG No data
1046974737_1046974743 19 Left 1046974737 8:120261854-120261876 CCTGGGAATGTCTTTTGCAATTG 0: 1
1: 0
2: 0
3: 7
4: 168
Right 1046974743 8:120261896-120261918 GTTAAAAGTCAAGGCTGAGAGGG No data
1046974737_1046974739 -9 Left 1046974737 8:120261854-120261876 CCTGGGAATGTCTTTTGCAATTG 0: 1
1: 0
2: 0
3: 7
4: 168
Right 1046974739 8:120261868-120261890 TTGCAATTGAAGGAAACCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046974737 Original CRISPR CAATTGCAAAAGACATTCCC AGG (reversed) Intronic
904053774 1:27656890-27656912 CCATTGCCGAAGAGATTCCCTGG - Intergenic
906931377 1:50172987-50173009 CAAATGCAAAATTAATTCCCTGG + Intronic
909735711 1:78958770-78958792 CAATTTTAAAAGATATTCCATGG + Intronic
914937198 1:151992185-151992207 AAATTGCAAAAGATAATGCCAGG - Intronic
915076656 1:153313198-153313220 AAATTGAAAAGCACATTCCCAGG + Intergenic
916667767 1:166982063-166982085 CAATTGAGAAAGACATTGCAAGG + Intronic
919169284 1:193933615-193933637 CAAGGGCAAAAGACAATGCCTGG - Intergenic
919198312 1:194317295-194317317 TAATTACAAAAGACAGCCCCAGG + Intergenic
920633190 1:207672605-207672627 CAACAGCAAAAGACATTCTCTGG + Intronic
921742898 1:218706826-218706848 CAATTTCCAAATACATTCCATGG - Intergenic
1063178711 10:3576142-3576164 TAATTGAAAAAAACATTCACAGG - Intergenic
1063930472 10:11023567-11023589 TAAATGAAAAATACATTCCCAGG - Intronic
1071435275 10:85643219-85643241 CAATTGCTAAAGAAGTTTCCAGG + Intronic
1072367787 10:94731857-94731879 GAATTGCAAAAGAAATACCTAGG + Intronic
1072432956 10:95389802-95389824 CAAGTGCAAAAGGCATTGACTGG - Intronic
1077892626 11:6430459-6430481 CATTTGCAGAACACAGTCCCTGG - Intergenic
1080989822 11:37518039-37518061 GAATGGGAAAAGATATTCCCTGG + Intergenic
1081267736 11:41047702-41047724 CAGTTCCAAAAGGCATTACCAGG - Intronic
1082823184 11:57558764-57558786 CTATTCCAAAAGACCTTTCCTGG + Intronic
1087070593 11:94076192-94076214 CACATGCAATAGACATTTCCGGG - Intronic
1087165583 11:94999142-94999164 CAATATCCAAAGACATTCCAGGG - Exonic
1087198866 11:95325812-95325834 CAAGTGCAGAAGAAAGTCCCTGG - Intergenic
1087267848 11:96080371-96080393 AAAATGCAAAAGCTATTCCCTGG - Intronic
1087536381 11:99451823-99451845 CAAATGCAAAATTCATTCCACGG - Intronic
1091645446 12:2269182-2269204 AATATGCAAAAGACATTCCAAGG + Intronic
1091834293 12:3574605-3574627 AAAGTGCATAAGACATTGCCTGG - Intronic
1092085135 12:5750835-5750857 CAATTGAAGAAGATATTCCCAGG - Exonic
1095715245 12:45338393-45338415 CTGTTGCAAATGTCATTCCCAGG - Intronic
1098809853 12:75073046-75073068 GAATTGCAGAACTCATTCCCAGG + Intronic
1099045559 12:77713095-77713117 CAATTGAAAAAGCCATTTCTTGG - Intergenic
1099118059 12:78652000-78652022 TTATTGAAAAAGACATTCCTGGG + Intergenic
1099118190 12:78653174-78653196 CAAATGAAAATGACATTTCCTGG + Intergenic
1099537790 12:83866203-83866225 CAACTGAAAAAGAAATTCTCAGG + Intergenic
1101172206 12:102109627-102109649 CAAATTCAAAAGACATTAGCAGG - Intronic
1102552216 12:113699783-113699805 CAATTGCACAAGCCATTTGCAGG - Intergenic
1105044162 12:132987616-132987638 CACCTGCGAAAGTCATTCCCAGG - Intronic
1106196694 13:27500097-27500119 CAATTTGAAAACACATTTCCAGG + Intergenic
1109429999 13:62219676-62219698 CAATTTCAAACAACATTCTCTGG - Intergenic
1109876401 13:68409700-68409722 GAATTAGAAAAGTCATTCCCTGG - Intergenic
1110733299 13:78906186-78906208 CAATTTCAAGAAACATCCCCAGG + Intergenic
1111695154 13:91614184-91614206 CATTTGCAGAAAAAATTCCCAGG - Intronic
1112151073 13:96764839-96764861 CAAATGCAACAGGCATTCCAAGG - Intronic
1112311531 13:98321544-98321566 CAATACCAGAAGACATTCCAGGG + Intronic
1113149681 13:107249421-107249443 AAATTGCAAAAGAAAATGCCAGG + Intronic
1115011401 14:28550824-28550846 GTATTTCCAAAGACATTCCCAGG - Intergenic
1115382706 14:32757802-32757824 GAAGTGCACAAGACATTCCTGGG + Intronic
1116956784 14:50932166-50932188 CCACTGGAAAAGACAGTCCCAGG + Intronic
1117236102 14:53777538-53777560 AAATTGCAAAAGCAATTCACTGG + Intergenic
1118870518 14:69737345-69737367 CAGGTGGAAAAGACATTCCCAGG - Intronic
1120220859 14:81731111-81731133 CAATTCCAAAAGACTTTCAAAGG - Intergenic
1124029133 15:25993592-25993614 CATGTGCAAAAAATATTCCCTGG - Intergenic
1127089363 15:55451416-55451438 TAATGGCAAAAGACATTTCTAGG + Intronic
1127658013 15:61073875-61073897 AAATTTCAAAAGGCATGCCCTGG + Intronic
1132881030 16:2161773-2161795 CAATGGCAAAAGGCAAGCCCTGG + Intronic
1133658060 16:7885926-7885948 AAAATGCAAGAAACATTCCCAGG + Intergenic
1134688718 16:16176708-16176730 CAATTAAAAAACACATTCTCTGG + Intronic
1138339320 16:56278433-56278455 CAACTGGAAAAGGCGTTCCCGGG + Intronic
1138974624 16:62188786-62188808 TCACTGCAAAACACATTCCCTGG - Intergenic
1139093228 16:63674616-63674638 CAATTTAAAAAGACATTCTTGGG + Intergenic
1140824467 16:78692966-78692988 CCATAGCAAAAGGCATCCCCAGG - Intronic
1141664561 16:85459206-85459228 CAATTGCAAACGCCACCCCCAGG + Intergenic
1141675073 16:85513542-85513564 CAACCTCAAAACACATTCCCAGG + Intergenic
1144275086 17:13658887-13658909 CAATTGAAAAAAACATTGTCTGG + Intergenic
1146296761 17:31656073-31656095 CAATTCCAAAAGAGAGTCACTGG - Intergenic
1149401588 17:56301971-56301993 CAATTGAAAAAGGAATTCCTTGG + Intronic
1156104750 18:33646751-33646773 CATTTGCAAAAGACAAACCAAGG - Intronic
1156856515 18:41788531-41788553 GATGTGGAAAAGACATTCCCTGG + Intergenic
1156905844 18:42351178-42351200 CAATTGCTAAAGAAATTGACAGG + Intergenic
1158211255 18:55053133-55053155 CCAGTGCCAAAGAAATTCCCTGG + Intergenic
1158652342 18:59299336-59299358 TAATCTGAAAAGACATTCCCGGG + Intronic
1158951087 18:62495848-62495870 CAATTTTTAAAGACATTCTCAGG + Intergenic
1160329120 18:77976486-77976508 TTATTGAAGAAGACATTCCCTGG + Intergenic
1162850043 19:13423991-13424013 CATTTGCAAGGGACACTCCCTGG - Intronic
1165543776 19:36516220-36516242 CAAATACAAATAACATTCCCAGG + Intronic
1166590742 19:43996174-43996196 AAATTGCAAAAGACTTAACCAGG + Exonic
927750103 2:25661107-25661129 TAATTGCAAAAGACATAAACAGG - Intronic
933061530 2:77742893-77742915 GAAAGGCAAAAGAAATTCCCAGG - Intergenic
935205467 2:100893054-100893076 CAACACCAAAAGCCATTCCCTGG + Intronic
935643474 2:105312391-105312413 AAATTTCAAAATACATACCCAGG + Intronic
936941185 2:117886168-117886190 CAATTCCTAAAGCCCTTCCCTGG + Intergenic
940490337 2:154351211-154351233 CATTTCCAAAAGATATTCCATGG - Intronic
940671301 2:156671799-156671821 CAAATGCCAAAGACATTGGCTGG - Intergenic
941339115 2:164283892-164283914 CAGTTGCAAAAGAAATTCTATGG - Intergenic
945886569 2:215382126-215382148 TAATTGCAAAAGACATGTCGTGG + Intronic
948925933 2:241097725-241097747 CACTTGGAAAAGAATTTCCCAGG + Intronic
1171111491 20:22487157-22487179 CAGTTGCAAAAGAGATTCAGTGG - Intergenic
1172749515 20:37240418-37240440 CAGTTCCAAAAGACATGCACAGG - Intronic
1173966048 20:47113672-47113694 CCACTGCAAAGGTCATTCCCAGG + Intronic
1174095720 20:48088059-48088081 CAATTAAAAGAGACATCCCCTGG + Intergenic
1177476495 21:21630788-21630810 CAATTGCAACAAATATACCCCGG + Intergenic
1177649635 21:23943740-23943762 CAAATATAAAAGACATTCTCAGG + Intergenic
1178390243 21:32192239-32192261 CATTTGCAAAATACATCCACAGG - Intergenic
1178573943 21:33767807-33767829 CAATTAGAAAAGAAATTACCTGG + Exonic
1178844464 21:36162847-36162869 CAACTGCTAAATACATTCCCTGG - Intronic
1182847329 22:33442437-33442459 CTGTTGAAAAAGAAATTCCCAGG - Intronic
1183559460 22:38559629-38559651 CAAGTGCACAAAACAATCCCTGG - Intronic
1184590379 22:45478016-45478038 CAAGTGCCAAAGTCTTTCCCTGG - Intergenic
949200426 3:1371604-1371626 AAATTTCAAAGGACAATCCCAGG - Intronic
949897174 3:8776576-8776598 CAATGGCATGAGACAGTCCCTGG + Intronic
950816584 3:15709986-15710008 CATTTGCAAAAGAGATTCTGAGG + Intronic
953096513 3:39781880-39781902 CAATTGCAAAGGACAGACACTGG - Intergenic
954003380 3:47575123-47575145 CACTTGAAAAAGAGATACCCTGG + Intronic
955083343 3:55678159-55678181 CAATTGCAAAATCGATTCCTGGG - Intronic
955781699 3:62491371-62491393 CAATTGCACAATCCATTCACAGG - Exonic
955903137 3:63778624-63778646 CAAATGCAAAGGAAAATCCCAGG + Intergenic
960043619 3:113175249-113175271 CCATTGCAAAATACATGCCAAGG - Intergenic
961588939 3:127960373-127960395 CAAATGCAAAATATATACCCTGG - Intronic
962472271 3:135720996-135721018 CACTTGCAAAAGAAATTCTTTGG + Intergenic
965845553 3:172957294-172957316 TAATTCCAAAAGGCTTTCCCAGG - Intronic
967045116 3:185729276-185729298 CAAGTACAAATGACATACCCAGG - Intronic
967056551 3:185834123-185834145 TTATTGCAAAAGAAAATCCCAGG + Intergenic
967359312 3:188611507-188611529 CAATTGCAACAGATTTACCCAGG + Intronic
968399325 4:278343-278365 TATTTGCAAAAGACAATTCCTGG + Intronic
970764446 4:19530952-19530974 AAAATGCAAAATACATTGCCGGG + Intergenic
974847726 4:67371237-67371259 CACTTGGGAAAGAAATTCCCAGG - Intergenic
974932949 4:68380780-68380802 TAATTGCAAAATAAATTCCATGG - Intergenic
975226635 4:71880219-71880241 TAAATGCATCAGACATTCCCAGG + Intergenic
975497412 4:75049787-75049809 CAATTGCAAAATTCATTTCCTGG - Exonic
976868049 4:89754923-89754945 CAAATGCAAAAGAAATTCATTGG + Intronic
978203018 4:106045299-106045321 CAATTAAAAGACACATTCCCTGG - Exonic
978323061 4:107519468-107519490 CATTTGGAAAAATCATTCCCAGG - Intergenic
978718897 4:111880846-111880868 CAAATGCAAAAGAAATTTCAAGG + Intergenic
982357485 4:154486909-154486931 CAATTGCAACAAACCTTTCCAGG - Intronic
983060742 4:163156644-163156666 CCATTACAAAACATATTCCCAGG + Intronic
984371219 4:178868457-178868479 GAATAACAAAATACATTCCCAGG + Intergenic
985878277 5:2617671-2617693 CAAATGCAAGAGACATACCTGGG - Intergenic
987214313 5:15717171-15717193 CAAATGCATATGACCTTCCCCGG - Intronic
988480067 5:31622056-31622078 CAACAACAAAAGACATTCCAGGG + Intergenic
989639459 5:43569124-43569146 CAAGTGCAAAAGACACCCCTTGG + Intergenic
990629631 5:57653781-57653803 CTATTTTAAAAGACAATCCCAGG + Intergenic
995764852 5:115603419-115603441 CAATCGCCAAAGAGACTCCCAGG - Intronic
998578350 5:143342696-143342718 CAATTACAAAGCACATTTCCTGG - Intronic
999690026 5:154138722-154138744 TAATGGGAATAGACATTCCCAGG + Intronic
1000365615 5:160488090-160488112 CTAATCCAAAAGTCATTCCCAGG - Intergenic
1001344566 5:170881136-170881158 AAATTGCAAAAAACATTCTTAGG + Intronic
1004086340 6:12453227-12453249 CAAGTGCAAGAGCCACTCCCTGG + Intergenic
1005521214 6:26602178-26602200 CAGCTGCAAAAGACATTGCCAGG - Intergenic
1009762108 6:68020558-68020580 CAATAGAAAAAGATATTCTCTGG - Intergenic
1010490309 6:76468156-76468178 CACTTGTAGAAGACATTGCCTGG + Intergenic
1012669086 6:102017462-102017484 CAATTGCATATGATATTCCTAGG + Intronic
1014275647 6:119385210-119385232 TATTTGCAAAAGAAATTCTCTGG + Intergenic
1017230250 6:152065788-152065810 CAAGAGCATAAGACATTTCCAGG - Intronic
1017745656 6:157444743-157444765 CAGTTGCAGAAGACATTCTGTGG + Intronic
1019125432 6:169837575-169837597 CATGTGCAAGACACATTCCCAGG - Intergenic
1020741517 7:12025353-12025375 TCCTTGAAAAAGACATTCCCGGG - Intergenic
1022110689 7:27229160-27229182 TTTTTGCAAAAGACATTCACTGG - Intergenic
1025582110 7:62732884-62732906 CAATGGCAAAAAAAAATCCCAGG + Intergenic
1028743265 7:94300467-94300489 CAAGTGCAAAAGGCATTTCTGGG + Intergenic
1031429177 7:121645311-121645333 CAATTGCAACTTCCATTCCCGGG + Intergenic
1033138077 7:138801274-138801296 CACTGGCAAAAGCTATTCCCAGG - Intronic
1034826754 7:154272394-154272416 TAATTGAAAAAGACAATCCGAGG + Intronic
1036453428 8:8889405-8889427 CAATTACAAAAGATTTTCTCTGG + Intronic
1036950925 8:13138464-13138486 CAATTTCCAAAGAGATTGCCTGG - Intronic
1041430361 8:57774903-57774925 CCATTTCAAAAGACATTACAAGG + Intergenic
1042813988 8:72857828-72857850 CTATTGCAAAATACATTGTCGGG - Intronic
1044147944 8:88740945-88740967 TAATTGCAAAAGATGATCCCTGG - Intergenic
1046111809 8:109734529-109734551 CAATGGCATAAAACATTCCCAGG - Intergenic
1046212936 8:111102222-111102244 CACATGCAAAATACATTACCTGG + Intergenic
1046327669 8:112671310-112671332 TCATTGAAAAAGACATTCCTGGG - Intronic
1046974737 8:120261854-120261876 CAATTGCAAAAGACATTCCCAGG - Intronic
1047154479 8:122301554-122301576 CAATTTCAAATAACATTTCCTGG + Intergenic
1048218738 8:132521115-132521137 CAGTTCCAAAAGCCATGCCCTGG + Intergenic
1048545036 8:135378747-135378769 CAATGGCACTAGACATTTCCAGG - Intergenic
1050086011 9:1966439-1966461 AAATTTCAAAATACATTTCCAGG - Intergenic
1050629282 9:7541766-7541788 CATTCTCAAAAGACATTCCAGGG - Intergenic
1053364128 9:37511023-37511045 CAAGTGCAAAGGACAGTGCCAGG + Exonic
1188188977 X:27150642-27150664 ACATTGAAAAAAACATTCCCAGG + Intergenic
1188608834 X:32070478-32070500 CAATTGCAAGTGATATTCTCAGG - Intronic
1189535077 X:41926828-41926850 CAACTGCACTAGACATTCTCAGG + Intergenic
1190224027 X:48531927-48531949 AAATTGCAAAAGAAATTGTCAGG - Intergenic
1194119728 X:89946675-89946697 CTATTGCAAAACACATTCAGAGG - Intergenic
1196324652 X:114388939-114388961 TAATTTAAAAAGACATTCCTGGG + Intergenic
1198257962 X:134941556-134941578 CCATTCCAAATGACATTCCAGGG - Intergenic
1198856935 X:141028103-141028125 CTATTGCAAATGAAATTCCTTGG + Intergenic
1198905759 X:141559264-141559286 CTATTGCAAATGAAATTCCTTGG - Intergenic
1200472594 Y:3604207-3604229 CTATTGCAAAACACATTCAGAGG - Intergenic