ID: 1046974845

View in Genome Browser
Species Human (GRCh38)
Location 8:120262880-120262902
Sequence AAGAATCCACTGTGGGTGGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 270
Summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 241}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046974845 Original CRISPR AAGAATCCACTGTGGGTGGA GGG Exonic
901110927 1:6794505-6794527 AAAAATCCATTTTGGGTGAATGG + Intronic
901112531 1:6810012-6810034 AAGAAACCACTGTGGCCTGATGG + Intronic
902372509 1:16015284-16015306 AAGAACCCACTGTGGGTCAGGGG - Exonic
903904384 1:26673469-26673491 AAAAACCCACTGTGTTTGGAAGG + Intergenic
904172317 1:28599933-28599955 AAGAATCCCCTGTGCCTGCATGG - Intronic
904925276 1:34042777-34042799 TAGAAGCCAGTGTGGGTAGAGGG - Intronic
905536212 1:38723975-38723997 AAGAATGCACTGTGGGTGAAGGG - Intergenic
905691990 1:39950202-39950224 AAGTAATCACTGTGGGAGGAGGG - Intergenic
905739518 1:40357723-40357745 AAGAATTCACTGTAGGTGTATGG + Intronic
906141607 1:43537000-43537022 AAGAAACCACAGTGGGAGGGTGG - Intronic
908598734 1:65716195-65716217 ATGAATTCACTGTGGGTGTGTGG + Intergenic
909000118 1:70207693-70207715 AAGAATCTATTGTAGGGGGAGGG - Intronic
910241097 1:85086978-85087000 AGGAAGCCAGTGTGGCTGGATGG - Intronic
910727120 1:90350840-90350862 AAAAATCTACTGTGGGTCTAAGG + Intergenic
910927789 1:92413980-92414002 AAGAATTGACTGTGTGTGTAGGG - Intergenic
912302336 1:108530952-108530974 AAGGATCCACTGAGCTTGGAAGG + Intergenic
912723587 1:112040387-112040409 AGGAATCCACTGTGGCTGGAGGG - Intergenic
914503198 1:148265367-148265389 CAAAATCCACTGTGGGTTTAGGG + Intergenic
914986249 1:152459692-152459714 AAGAGGCCAGTGTGGCTGGAAGG + Intergenic
917176259 1:172239012-172239034 CACAATCCACTGTGAGTGCAAGG + Intronic
918111533 1:181459154-181459176 AAGCAACCACTATGGGAGGATGG + Intronic
918751928 1:188283007-188283029 AAGAATTAACTCTGGGAGGAGGG + Intergenic
918846397 1:189620493-189620515 AAGAAAGCACTGTGTGTGTATGG - Intergenic
919777207 1:201202006-201202028 AAGAAGTCCCTGTGGATGGATGG - Intronic
919927858 1:202201752-202201774 CAGAAACCACTGCTGGTGGATGG - Intronic
922469436 1:225866836-225866858 AAGTATTCACTGTGGGCTGAGGG - Intronic
923035897 1:230285004-230285026 AAGCTTCCACTGGTGGTGGAAGG + Intergenic
923919915 1:238552331-238552353 GAGAAAGCAGTGTGGGTGGAAGG + Intergenic
1062897455 10:1115103-1115125 AAGCCTCCTCTGTGGGTGGCAGG + Intronic
1064447022 10:15404518-15404540 ATGAATTCACTGTAGGTGTATGG - Intergenic
1065555627 10:26912744-26912766 TAGAAGCCATTGAGGGTGGAGGG - Intergenic
1069436468 10:68388595-68388617 AGGAGGCCACAGTGGGTGGATGG + Intronic
1070781772 10:79141800-79141822 AATAATCCAGTGTGGCTGGGAGG + Intronic
1070943823 10:80371729-80371751 CAGAATCCACAGTGAGGGGAGGG + Intergenic
1072682642 10:97517831-97517853 CAGAAGCCAGTGTGGGTGAAGGG - Intronic
1073344938 10:102775985-102776007 CAGAGCCCACTGTGGGAGGATGG - Intronic
1073934071 10:108609605-108609627 TAGAGTCTACTGAGGGTGGAGGG + Intergenic
1075174536 10:120147123-120147145 ATGAATCTACTGTGGGGAGAGGG - Intergenic
1076582432 10:131520544-131520566 AAGACCGCAATGTGGGTGGAGGG - Intergenic
1076838509 10:133033119-133033141 AAGCTTCCACTCTTGGTGGAAGG - Intergenic
1077231078 11:1458460-1458482 AAGCATCCAGTGTGGGAGGGGGG - Intronic
1078449409 11:11429148-11429170 CAGAAGCCACTGGGTGTGGAAGG - Intronic
1079007400 11:16801656-16801678 GAGAGTCCACTGTGCGTAGAGGG - Exonic
1079641010 11:22805645-22805667 AAGAATCCACTCTTGGTGTCTGG - Intronic
1083538879 11:63497353-63497375 ATGAGTTCACTGTGGGTGTATGG + Intergenic
1085767554 11:79296342-79296364 GAGAATTCACCATGGGTGGAAGG - Intronic
1086330539 11:85749577-85749599 AAGAGTTTACTCTGGGTGGAAGG - Intronic
1086956686 11:92941069-92941091 AAGCATCCTCTGTGGGTGAGGGG - Intergenic
1087976557 11:104556820-104556842 AAGAAGCTACCCTGGGTGGATGG + Intergenic
1088364467 11:109024840-109024862 ATGAATTCACTGTAGATGGATGG + Intergenic
1092604265 12:10101610-10101632 AAGCTACCACGGTGGGTGGAGGG - Intronic
1093273779 12:17098508-17098530 AATAGTCCACAATGGGTGGATGG + Intergenic
1095524060 12:43104385-43104407 GAGAAGCCACCTTGGGTGGATGG + Intergenic
1099176171 12:79425188-79425210 AAGAAGTGACAGTGGGTGGAAGG - Intronic
1100939719 12:99712838-99712860 AATAATCCTCTGTGGCTGGAGGG + Intronic
1104610095 12:130220594-130220616 AAGAATCCACAGAGCATGGAGGG - Intergenic
1104765719 12:131328620-131328642 ATGAATGCACTGCGGGTGGATGG - Intergenic
1104791167 12:131483031-131483053 AAGAATCCACTGTCCATGCACGG + Intergenic
1104813546 12:131633240-131633262 ATGAATGCACTGCGGGTGGATGG + Intergenic
1107004833 13:35597910-35597932 AAGAGGTCACTGAGGGTGGAGGG + Intronic
1107085678 13:36425634-36425656 ATGAGTCCACTGTAGGTGTATGG - Intergenic
1107738363 13:43422050-43422072 AAGAACACAATGAGGGTGGAGGG + Intronic
1109666968 13:65552789-65552811 AGGAATCCACTGTGCTTGGTGGG + Intergenic
1109843859 13:67957977-67957999 AAAAATCCACTGTGGGGTGGGGG + Intergenic
1111376458 13:87385135-87385157 TAAAATCCACTGTGGATGGGAGG - Intergenic
1112217609 13:97449554-97449576 AAGAATTCACTGTGGGGCAAGGG - Intronic
1112601290 13:100858039-100858061 CAGAATCCACTTTGGGTGCTTGG - Intergenic
1112693495 13:101920680-101920702 ATGCATCCACTGTGGGGGGGTGG - Intronic
1113321687 13:109238613-109238635 CAGAATCCACTGTTGGTCTAGGG - Intergenic
1114549264 14:23523798-23523820 CAGAATCCCCTGGGGCTGGAGGG - Exonic
1118235605 14:64001922-64001944 AAGATTCCATTCTGGGTGCAAGG - Exonic
1120342756 14:83243326-83243348 TAGTCTCCACTCTGGGTGGATGG + Intergenic
1122312226 14:100804486-100804508 AGGGCTCCACTGTGGGTGGATGG - Intergenic
1122412054 14:101530638-101530660 ATGAGTCAACTGTGGGTGGATGG - Intergenic
1122815700 14:104311376-104311398 GAGAATGCACTGTGGTTAGATGG - Intergenic
1125072069 15:35567168-35567190 TAGATGCCACTGTGGTTGGATGG - Intergenic
1125501959 15:40245491-40245513 AAGAAAGCACAGAGGGTGGAGGG + Intronic
1126200445 15:45979454-45979476 AAGAGTCCACTGAAGGTGGAGGG - Intergenic
1126727527 15:51647409-51647431 AGGAAGCCAGTGTGGCTGGATGG + Intergenic
1127568435 15:60215879-60215901 ATGAATCTACTGTGGGTGGCTGG + Intergenic
1129285731 15:74523036-74523058 TAGAATCAAGTATGGGTGGAGGG + Intergenic
1129706189 15:77795914-77795936 AAGATGCCACTCTGGGTGGCAGG - Intronic
1131184510 15:90263451-90263473 CAGAAGCCACTGAGGGTGGTGGG - Exonic
1131964446 15:97826481-97826503 AAGAAGCCAGAGTGGGTGGTGGG - Intergenic
1134095726 16:11417214-11417236 AACAATCCACAGTGGATTGAGGG - Intronic
1134205745 16:12236812-12236834 CAGAATCCACTAGGGGAGGACGG - Intronic
1134545434 16:15104362-15104384 TATCATCCACTGAGGGTGGAAGG + Intronic
1136150259 16:28342990-28343012 TATCATCCACTGAGGGTGGAAGG + Exonic
1136166496 16:28456828-28456850 TATCATCCACTGAGGGTGGAAGG + Exonic
1136196477 16:28658204-28658226 TATCATCCACTGAGGGTGGAAGG - Exonic
1136212817 16:28772329-28772351 TATCATCCACTGAGGGTGGAAGG - Exonic
1136532162 16:30876925-30876947 AAGAAGCCCATGTGGCTGGAGGG + Intronic
1138565282 16:57828452-57828474 AAGAAGCCAACGTGGGTGGCGGG + Intronic
1138614963 16:58157986-58158008 CAGACTCCACAGTGGGGGGACGG - Exonic
1139172390 16:64647813-64647835 AAGAAGGCACTGAGAGTGGATGG + Intergenic
1139361148 16:66401038-66401060 GAGAAGACACAGTGGGTGGAAGG + Intronic
1139878360 16:70164328-70164350 AAGGCTCCACTGTGGGATGATGG - Intergenic
1140359202 16:74330488-74330510 AAGGCTCCACTGTGGGATGATGG + Intergenic
1140367236 16:74391567-74391589 TATCATCCACTGAGGGTGGAAGG - Exonic
1140627612 16:76813035-76813057 AAGAATCCAAGTGGGGTGGAGGG + Intergenic
1142498273 17:317936-317958 AAGAAACAACAGAGGGTGGAGGG - Intronic
1144554028 17:16265971-16265993 AAGAGTCCTCTCTGGGTGAAAGG - Intronic
1144737736 17:17564325-17564347 AAGATTCCACTGGGGGCAGAGGG - Intronic
1146551167 17:33781507-33781529 AAGGATCCACTTTTGGTGAATGG - Intronic
1147655771 17:42090055-42090077 AAGAGCCCAGTGTGGCTGGAAGG - Intergenic
1147970150 17:44214996-44215018 AAGCATTAACTCTGGGTGGAGGG - Intronic
1148536150 17:48440689-48440711 ATGAGTCCACTGAGGGTGGGAGG - Intergenic
1149108933 17:53002909-53002931 ACGAATTTACTGTGGGTGTATGG - Intergenic
1149259073 17:54859257-54859279 AAGCAGCCACTGTGGAAGGATGG + Intergenic
1151011149 17:70497884-70497906 TACATTCAACTGTGGGTGGAAGG + Intergenic
1152016878 17:77756643-77756665 AAATATCCACTGTGGGTGAGGGG + Intergenic
1152307596 17:79530369-79530391 AAGAACGCTCTGTTGGTGGATGG - Intergenic
1153816218 18:8792663-8792685 CAGAAGCCACTGTGGGAGCAAGG + Intronic
1154116968 18:11619721-11619743 TATCATCCACTGAGGGTGGAAGG + Intergenic
1154473811 18:14731508-14731530 AAGAACCCCCTGGGGGTGCATGG + Intronic
1155799611 18:30084254-30084276 AAGAATCTACTTTGGGTTCAAGG + Intergenic
1157146614 18:45169697-45169719 AAGAAGCCACTGTGGGAAAATGG - Intergenic
1157456148 18:47830006-47830028 AAGAATCCACAGTGGTTTGCAGG + Exonic
1157494023 18:48142592-48142614 AGGCACCCACTGTGGGAGGAGGG + Intronic
1158763736 18:60422176-60422198 AAAAATCCACTGTAGGTTGGGGG - Intergenic
1158942145 18:62414659-62414681 AAGAATGCATTGGGGATGGAAGG - Intergenic
1159903016 18:74065885-74065907 AGGAATCCACAGTGGGTGAAGGG - Intergenic
1160560977 18:79755615-79755637 GAGAAACCACTGTGGAAGGAGGG - Exonic
1162372250 19:10286704-10286726 AAGAAAACATTGTGGGTTGATGG + Intergenic
1163519356 19:17782815-17782837 AAGAATCCACCCTGGGCTGAAGG - Intronic
1164000342 19:21092539-21092561 AAGAATGCAATGTAAGTGGACGG - Intronic
1165384904 19:35504642-35504664 ATGAATCCACTGTAGCTGGGTGG + Intronic
1166009371 19:39930268-39930290 ATGAATTCACTGTAGGTGGGTGG - Intronic
1167513063 19:49906944-49906966 TAAAATCCACTGTGTGTGGAAGG - Intronic
926592149 2:14751295-14751317 AAGAAGCCACTGTGGGGGGCTGG - Intergenic
927939072 2:27092511-27092533 ATGTATCCACCCTGGGTGGATGG + Intronic
929016756 2:37505094-37505116 AAGAATTCGGTGTGGCTGGAGGG + Intergenic
935103360 2:100017295-100017317 AATAATACACTGTGGGTGAAAGG - Intronic
935175629 2:100646279-100646301 AGGCATCCCCTGTGGGAGGAAGG - Intergenic
936461494 2:112717699-112717721 AAGATTGCAGTGTGGGTGGTGGG - Intergenic
936983378 2:118285066-118285088 AAGAAAACACTGTGTGTAGAGGG - Intergenic
938555694 2:132422072-132422094 ATGAATCCAATGTGGCTTGAGGG + Intronic
938922554 2:136008484-136008506 AAGAAGCCACTGTGGAAGGCGGG + Intergenic
939256371 2:139749200-139749222 AGGAATGCAATGAGGGTGGAAGG - Intergenic
940220547 2:151346920-151346942 AAGAATCAACTGGGGGAGGCTGG - Intergenic
940793413 2:158052000-158052022 AATTATCCACTGTGGGTAGCAGG - Intronic
942094751 2:172526352-172526374 CAGAATCCACTTTGGGAGGGTGG - Intergenic
942408000 2:175676046-175676068 GAGACTGCTCTGTGGGTGGATGG + Intergenic
943487644 2:188507047-188507069 AAGAATGCAAAGTGGGTGGATGG - Intronic
944143326 2:196480269-196480291 AAGTATAAACTGTGTGTGGAAGG - Intronic
944294265 2:198044290-198044312 GAGAAGCCACTGTGAATGGATGG - Intronic
945658920 2:212659913-212659935 AGAAATGCACTGGGGGTGGATGG - Intergenic
945971759 2:216237837-216237859 ATGAACCCACTGTGGGAGGATGG + Intergenic
946299463 2:218813838-218813860 ATGAATCCACAGTGGGATGAGGG - Intronic
946895842 2:224322495-224322517 AAGAAGACAGTGTGGCTGGAAGG + Intergenic
947473527 2:230419811-230419833 AAGCATCCCCTGTGGATAGAAGG + Intronic
949000598 2:241610686-241610708 AGGACTCCACGGTGGGTGGTGGG - Intronic
1169539366 20:6582427-6582449 AAGGTACCAGTGTGGGTGGAAGG + Intergenic
1169895492 20:10501339-10501361 AAGGATAGACTGTGGGGGGAGGG - Intronic
1169950710 20:11040388-11040410 AAGACTTTACTGTGGCTGGACGG + Intergenic
1170914065 20:20605732-20605754 AAGTAGCCACTGTGGATGGTAGG - Intronic
1171198590 20:23223237-23223259 TAGAAGCCACAGAGGGTGGAGGG - Intergenic
1172701977 20:36859221-36859243 AGGAACCCACTGGGTGTGGATGG - Intronic
1172822924 20:37754439-37754461 CTGACTCCACAGTGGGTGGATGG + Intronic
1174354680 20:49989954-49989976 CAGCACCTACTGTGGGTGGATGG - Intergenic
1175986165 20:62765111-62765133 CAGGCTCCACTGTTGGTGGAGGG - Intergenic
1179511630 21:41877722-41877744 AAAAATCAACTGTAGTTGGAAGG - Intronic
1180801207 22:18632784-18632806 GAGACCCCACAGTGGGTGGATGG + Intergenic
1180852436 22:19028343-19028365 GAGACCCCACAGTGGGTGGATGG + Intergenic
1181220514 22:21362477-21362499 GAGACCCCACAGTGGGTGGATGG - Intergenic
1182079223 22:27517460-27517482 AAGAATCCACAATGGGGGGTGGG + Intergenic
949862569 3:8519861-8519883 AAGACTCCAATGTTGGTTGAAGG + Intronic
952843359 3:37666817-37666839 AATCATCCACTGTGGGAGCAGGG - Intronic
952919021 3:38271949-38271971 AACCATCCACTGTGGGTGTTGGG + Intronic
954799948 3:53181270-53181292 AAGAACTCCCTGGGGGTGGAGGG + Intronic
956735001 3:72231600-72231622 ACGAATCCACTGTGGGTCAAAGG - Intergenic
957605115 3:82388842-82388864 ACTAATCAACTGTGGTTGGATGG + Intergenic
958602594 3:96316595-96316617 ATGAATTCACTGTAGGTGTATGG + Intergenic
958914680 3:100035839-100035861 AAGAATCCAATGTGGGGGAAAGG - Intronic
960861646 3:122160365-122160387 ATGAATTCACTATGGGTGTACGG + Intergenic
960989388 3:123300920-123300942 CAGACTCCACTGGGGGTGGGAGG + Intronic
962530707 3:136277502-136277524 AAGTAACCAGGGTGGGTGGAGGG + Intronic
964172163 3:153783668-153783690 AAGATTCCTCTTTGGGTGGAGGG - Intergenic
964910039 3:161770068-161770090 AAAAATCCACTGTGGATGAAGGG + Intergenic
965755463 3:172021834-172021856 AAGACTCTACTCTGCGTGGAGGG - Intergenic
966142725 3:176774064-176774086 ATGAGTCCACTGTAGGTGTATGG - Intergenic
966317771 3:178667896-178667918 AACAGTCCACAGTGGGTGGTTGG + Intronic
967570487 3:191022486-191022508 AGGGAGCCACTGTGGCTGGAGGG + Intergenic
968561227 4:1283814-1283836 GAAATTCCACTGTTGGTGGAGGG - Intergenic
969432056 4:7161167-7161189 GAGAGTCCAATGTGGGAGGAGGG + Intergenic
969726756 4:8922745-8922767 CAGGATCCACTGTGGGTTGGAGG - Intergenic
970112036 4:12649643-12649665 AAGAAGCCATTTTGGGGGGAAGG + Intergenic
970722587 4:19005552-19005574 AAGAATTTGGTGTGGGTGGAGGG - Intergenic
970782776 4:19758833-19758855 AAAAGGCCACTGTGGCTGGAAGG - Intergenic
971137158 4:23881847-23881869 AAAAGTCCACTGTGAGTGGCCGG + Intronic
971419229 4:26460482-26460504 AAGAATCCCCTGGGGGAGGGCGG + Intergenic
973036365 4:45412406-45412428 AAGCTTCCACTCTTGGTGGAAGG - Intergenic
974856869 4:67471084-67471106 AACAACCAACAGTGGGTGGAAGG + Intergenic
978537152 4:109774502-109774524 AAGGGGCCAGTGTGGGTGGATGG + Intronic
979307481 4:119163763-119163785 AAGAATCAGCTCTGGGAGGAGGG + Intronic
979956830 4:126963880-126963902 AAGAATTCAATGTGATTGGAAGG + Intergenic
982882272 4:160734535-160734557 AAGTTTCCACTGAGGGTGAATGG - Intergenic
983668092 4:170205150-170205172 AAGAACACACTGTGGGGGAAAGG + Intergenic
983720053 4:170839766-170839788 AAGAAACAAGAGTGGGTGGAGGG - Intergenic
986697293 5:10368973-10368995 AAATTTCCAATGTGGGTGGAGGG + Intronic
986782949 5:11084033-11084055 AAGCATACAGTGTGGGTTGATGG - Intronic
990876679 5:60494248-60494270 AAGAATGCACTGGGGGTAGGGGG + Intronic
991965051 5:72082367-72082389 AAGACTACACTGTGAGTGGGTGG + Intergenic
992856243 5:80864318-80864340 AGGAATAGAGTGTGGGTGGAGGG - Intronic
994986803 5:106944275-106944297 AAGCTCCCACTGTAGGTGGAGGG + Intergenic
996655645 5:125932074-125932096 AAGAATCCAAAGTAGGTAGAAGG + Intergenic
996969898 5:129353345-129353367 ATGAATTCACTGTAGGTGTATGG - Intergenic
997828180 5:137126256-137126278 AAGCATCCACTCATGGTGGAAGG - Intronic
1000104251 5:158043765-158043787 CAGCAACCACTGTGGGTGGCTGG + Intergenic
1001282729 5:170398909-170398931 AAGAATCCACTCTAGGTGTCTGG - Intronic
1001433771 5:171683600-171683622 AAGAATCAAATGTGGGGAGAGGG + Intergenic
1003164315 6:3663125-3663147 AAGGATCCACTGCAGGTGGTTGG - Intergenic
1004101704 6:12618833-12618855 AAGATTCTATTGAGGGTGGAGGG + Intergenic
1005164895 6:22908528-22908550 CAGAATTGACTATGGGTGGAGGG + Intergenic
1005205739 6:23402429-23402451 TAGAATCCAGTATAGGTGGAAGG + Intergenic
1005964107 6:30714346-30714368 AAACATCCATTGTGGATGGATGG - Intronic
1006092686 6:31637271-31637293 AAGACTCCACTGTAGGTGGAAGG - Exonic
1006121470 6:31809129-31809151 AGGACTCAACTGGGGGTGGAGGG - Intergenic
1006255600 6:32829775-32829797 AAGAATTCAGTGTGTGGGGAAGG + Intronic
1008563773 6:52747748-52747770 AAGAATCCCCTGGTAGTGGAGGG - Intergenic
1008572663 6:52830056-52830078 AAGAATCCCCTGGTAGTGGAGGG - Intergenic
1010773971 6:79864053-79864075 AACAAACCAGTGTGGGTGGCTGG + Intergenic
1017291356 6:152742413-152742435 GAGAATAGATTGTGGGTGGATGG + Intergenic
1018101331 6:160443413-160443435 AAGTCTCCAGCGTGGGTGGAGGG - Intronic
1019083925 6:169456644-169456666 AATCATCAACTGTGGGAGGAGGG + Intergenic
1021534171 7:21684214-21684236 AGGAATCCTGTGGGGGTGGAGGG - Intronic
1021845406 7:24757825-24757847 CACACTCCACTGTGGGTGGCGGG - Exonic
1022976998 7:35567781-35567803 CAGAAGCTACTGTGGGTGGCTGG + Intergenic
1023722532 7:43111657-43111679 AACTAGCCACTGTGGGTGGAAGG + Intergenic
1025253728 7:57369180-57369202 AGGAAGCCAGTGTGGCTGGAGGG - Intergenic
1026067680 7:67089429-67089451 AAGACTCCACTGCAGGTGGAAGG + Intronic
1026709245 7:72722902-72722924 AAGACTCCACTGCAGGTGGAAGG - Intronic
1028409190 7:90509426-90509448 AAGTCTCCACTGTGGGTGGCTGG + Intronic
1029516574 7:101027219-101027241 ATGAATCCAGTGTGGATGAAAGG + Intronic
1029520169 7:101055269-101055291 AGGTATCCACTGTCGGTGGGAGG + Intronic
1031382255 7:121101711-121101733 AAGCTTCCACTGATGGTGGAAGG + Intronic
1034221679 7:149451260-149451282 AAGAGCCCACTGTGGGTGTGGGG + Intronic
1034347322 7:150395545-150395567 CAGAGGGCACTGTGGGTGGAAGG - Intronic
1035015614 7:155763293-155763315 ACGTATCCACAGGGGGTGGAAGG + Intronic
1035075496 7:156174839-156174861 AAGATTTCACTGTGGTTTGAGGG - Intergenic
1035392060 7:158510939-158510961 AGGAATCCCCTGTGGGAGGCTGG - Intronic
1039561019 8:38512611-38512633 AGGAGTCCAGTGTGGCTGGAGGG + Exonic
1041377243 8:57216866-57216888 CAGATTCCACGGTGGGTAGACGG + Intergenic
1043850129 8:85206435-85206457 AGGGATCAACTGTGTGTGGAAGG + Intronic
1045710550 8:104978450-104978472 AAGAATACACAGTGGGTGACAGG - Intronic
1046974845 8:120262880-120262902 AAGAATCCACTGTGGGTGGAGGG + Exonic
1048604405 8:135952715-135952737 CAGACTGCCCTGTGGGTGGAAGG + Intergenic
1048671412 8:136727304-136727326 AATAATACACTGTTGGTGGATGG - Intergenic
1049149715 8:141026786-141026808 AAGAATCCAGAGTTGGTGGTGGG + Intergenic
1050595169 9:7197757-7197779 AAGAAGCTAGTGGGGGTGGAGGG - Intergenic
1051091800 9:13418531-13418553 AAGTATCCAGTTTGGTTGGAGGG - Intergenic
1054556731 9:66664714-66664736 AAGTATCCACAGTGGCAGGATGG - Intergenic
1055970334 9:81905608-81905630 AAGCATCCACTGTGGAATGAAGG + Intergenic
1056106535 9:83352708-83352730 AAGAATCTACTTAGGGTGGAGGG - Intronic
1056551747 9:87658503-87658525 AAGAATCCTCAGTGGGTGTTGGG + Intronic
1059926230 9:119211901-119211923 AAGAAACCACTTTAAGTGGATGG - Intronic
1185618310 X:1436678-1436700 AATATTCCACTGTGTGTGGATGG + Intronic
1187280868 X:17857877-17857899 AAGTATGCACTGTGGGTGACTGG + Intronic
1188852550 X:35150284-35150306 GAGAAGCCACTGAGAGTGGATGG + Intergenic
1192437692 X:71153116-71153138 AAGGATTCATTCTGGGTGGAAGG - Intronic
1193396947 X:80996125-80996147 TGGAATCCACTGTAGGTGTATGG - Intergenic
1194311038 X:92306937-92306959 AAGAATCCATTGGGAGGGGAAGG + Intronic
1195122478 X:101769523-101769545 ATGAATTCACTGTAGGTGTATGG + Intergenic
1198003243 X:132462636-132462658 TAGAAACCAGTGTGTGTGGAGGG + Intronic
1198310934 X:135425349-135425371 CAGAAGCCACTGGGGGTGGGCGG - Intergenic
1198808284 X:140509907-140509929 CTGAATACTCTGTGGGTGGAAGG - Intergenic
1199800697 X:151248200-151248222 AAGAATCCACTGAGGAGGAAAGG + Intergenic
1199841374 X:151653018-151653040 GAGAATAGACTGTGGGAGGAAGG + Intronic
1200619316 Y:5421227-5421249 AAGAATCCATTGGGAGGGGAAGG + Intronic
1200958370 Y:8973106-8973128 AGGTAACCACTGTGGGTAGAAGG + Intergenic