ID: 1046978469

View in Genome Browser
Species Human (GRCh38)
Location 8:120310648-120310670
Sequence GCCTGAACTCCATTAGTGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 3, 3: 3, 4: 80}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046978469_1046978471 3 Left 1046978469 8:120310648-120310670 CCAGTCACTAATGGAGTTCAGGC 0: 1
1: 0
2: 3
3: 3
4: 80
Right 1046978471 8:120310674-120310696 ACCATCTTCTCTCCAGCTCTTGG No data
1046978469_1046978474 19 Left 1046978469 8:120310648-120310670 CCAGTCACTAATGGAGTTCAGGC 0: 1
1: 0
2: 3
3: 3
4: 80
Right 1046978474 8:120310690-120310712 CTCTTGGCAAATCTTCTAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046978469 Original CRISPR GCCTGAACTCCATTAGTGAC TGG (reversed) Intronic
902335081 1:15749888-15749910 GCCTGGGCCCCATTAGGGACAGG + Intergenic
907955176 1:59221423-59221445 GCCTGAACTCAAATATTGACAGG - Intergenic
909738252 1:78994538-78994560 GCCTGCTTTTCATTAGTGACTGG - Intronic
910986883 1:93013928-93013950 GCCTGAACTCCAAGAGTAGCTGG + Intergenic
912734807 1:112141304-112141326 GCTTGAACTCCTCCAGTGACAGG - Intergenic
1064249857 10:13698678-13698700 TCCTGACCTCAATTAGTGATTGG - Intronic
1066351280 10:34639519-34639541 GCCTCAAGACCATTAGTGAGTGG - Intronic
1069796877 10:71059309-71059331 GCCTGGACACCATTAGTGAGTGG + Intergenic
1071526207 10:86360950-86360972 GCTTGATCTCCATCATTGACTGG - Intronic
1074364267 10:112845461-112845483 GCCTGGACTTCATTAATGCCTGG + Intergenic
1074650635 10:115520580-115520602 GCCTGAATGCCTTTAATGACAGG + Intronic
1076040651 10:127245240-127245262 GCATGAACTCCATTAGGAAACGG - Intronic
1077915735 11:6610627-6610649 GCCTGAACTCCAGAGGTGTCGGG + Exonic
1077922596 11:6652902-6652924 GCCTGAACTGGAGTAGTGGCCGG - Intronic
1078475453 11:11625359-11625381 GGCTGAATTCCATTAGTGACTGG - Intergenic
1079403816 11:20128006-20128028 GTGTGAACTCCAGTGGTGACAGG - Intergenic
1085818441 11:79766892-79766914 GCTTGAATTCCTCTAGTGACAGG + Intergenic
1087426793 11:97998674-97998696 CACTGCACTCCATTAGTGAAGGG - Intergenic
1091882814 12:3993171-3993193 GCCTGCATTCCACTAGTGCCTGG - Intergenic
1092907806 12:13117835-13117857 GCCTGAAAGGCATTAATGACAGG - Intronic
1098562087 12:71886049-71886071 GCCTGAACTGGGATAGTGACAGG + Intronic
1098945493 12:76584823-76584845 GCCTAAGCCCCATTAATGACAGG + Intergenic
1101872813 12:108579747-108579769 GCCAGAGCTCCATAAGAGACAGG + Intergenic
1107682436 13:42865709-42865731 CCCTGAACTTCATTATAGACAGG + Intergenic
1114879849 14:26770774-26770796 GTCTGAAGTCCATTAGTTTCAGG + Intergenic
1126133802 15:45370886-45370908 GCCTCAACTCCCTGAGTAACTGG + Intronic
1129699656 15:77760294-77760316 GCCTGGACACCCTTAGTGGCTGG - Intronic
1131749988 15:95495819-95495841 ACCTGAACTCCTCCAGTGACTGG + Intergenic
1133008940 16:2899541-2899563 GCCTGAGCTCCCTTAGTGCCTGG - Intergenic
1133810499 16:9157728-9157750 ACCTGACCTCCATTAGCCACAGG + Intergenic
1136695808 16:32080571-32080593 GCCTGATGGCCACTAGTGACTGG - Intergenic
1136796304 16:33023824-33023846 GCCTGATGGCCACTAGTGACTGG - Intergenic
1136873613 16:33830573-33830595 GCCTGATGGCCACTAGTGACTGG + Intergenic
1137936946 16:52643990-52644012 GCCCGGACTCCTTTAGTCACTGG - Intergenic
1139931324 16:70528988-70529010 GCCTAAAGGCCATGAGTGACCGG - Exonic
1140291780 16:73665928-73665950 GCCTCAACTTCATGAGTAACTGG + Intergenic
1203098561 16_KI270728v1_random:1285483-1285505 GCCTGATGGCCACTAGTGACTGG - Intergenic
1145275055 17:21424240-21424262 GCCTGAACTCCCTCAGGGTCTGG - Intergenic
1145312908 17:21710140-21710162 GCCTGAACTCCCTCAGGGTCTGG - Intergenic
1147812285 17:43181198-43181220 ACCTGAATTCCATTAGTTATGGG + Intronic
1158026713 18:52906982-52907004 TTCTGTACTCCATTAGTCACAGG + Intronic
1160622945 18:80183380-80183402 GCCTGAAACCCATTAGGGCCAGG - Intronic
1163934429 19:20429388-20429410 GCCTGAAATCAAATAGTTACAGG - Intergenic
1166895307 19:46018799-46018821 GCTTGGACTCCTTTAGGGACGGG - Intronic
925811116 2:7701810-7701832 GCCTGAACTCCAAAAGGGAGGGG - Intergenic
932993455 2:76817172-76817194 GCCTGAAAACCATGAGTGCCAGG + Intronic
934153479 2:89172484-89172506 GCCGGCTCTCCATTGGTGACGGG + Intergenic
934213756 2:90009447-90009469 GCCGGCTCTCCATTGGTGACGGG - Intergenic
937321409 2:120963144-120963166 CCCTTCACTCCATTATTGACTGG + Intronic
937641282 2:124214408-124214430 CCCTGCACTGCAATAGTGACTGG - Intronic
938220120 2:129559229-129559251 GCCTGAGCCCCATCACTGACTGG - Intergenic
939674127 2:145050663-145050685 GCCTGAAGACCTTTAGTGTCTGG + Intergenic
947162360 2:227227295-227227317 GCCTGTATTTCATTATTGACGGG - Intronic
948969060 2:241410019-241410041 GCATGAATTCCACTAGGGACAGG + Intronic
1179159880 21:38886031-38886053 GGCTGTACTTCATTTGTGACTGG + Intergenic
1182240529 22:28912549-28912571 GCCTTAACTTCATTATTGTCTGG + Intronic
1184835240 22:47017127-47017149 GCATCAACACCATTAATGACAGG - Intronic
951392418 3:22122895-22122917 GGGTGAACGCCATAAGTGACTGG + Intronic
952901038 3:38111942-38111964 GCCTGGACTCCATTTGGGATGGG + Intronic
953696395 3:45163428-45163450 GGGTGAACTTCATCAGTGACAGG + Intergenic
955117239 3:56017787-56017809 GTCTAAACTCCATTAGAGCCAGG + Intronic
956352759 3:68355828-68355850 GCCTGAACACCATAAGTGACAGG - Intronic
958741719 3:98081756-98081778 TCCTGAACTCCATTAGTGTCAGG + Intergenic
976186076 4:82443900-82443922 GCCTGTACTCCCTGGGTGACAGG - Intronic
981654223 4:147093616-147093638 GCCTATATTCCATTAGAGACGGG + Intergenic
984866290 4:184283544-184283566 GCCTGACCTCCAAGAGTGAAGGG - Intergenic
989096473 5:37786201-37786223 GCCTGAACTCCTTAAGAGAGAGG - Intergenic
999474500 5:151885934-151885956 GCCTGAACTAGATTAGGGGCGGG + Intronic
1002948719 6:1787433-1787455 GCCTGAACACCGATAGTGAATGG - Intronic
1006136347 6:31898288-31898310 GCCCGAACGTCATTACTGACTGG + Intronic
1010274084 6:73948903-73948925 GCCTGGACTCCAGTAGTTCCAGG - Intergenic
1011436431 6:87343085-87343107 TCCTGAACTTCCTTAGTGTCTGG - Intronic
1016527039 6:145013394-145013416 GCCTTGACTCCATTAGGGATGGG - Intergenic
1023893134 7:44408385-44408407 GCCTGAACTCCACTCTAGACTGG - Intronic
1031393426 7:121244305-121244327 GCCTCAACTCCAGCAGTGCCTGG + Exonic
1036527292 8:9547093-9547115 CCCTGAAGGCCATTAGTGAAGGG - Intergenic
1037605730 8:20435700-20435722 GCCTGCTCTCCAGTAGGGACCGG + Intergenic
1046978469 8:120310648-120310670 GCCTGAACTCCATTAGTGACTGG - Intronic
1049288524 8:141789468-141789490 GCCTGAGCTCCATTTCTGAAAGG - Intergenic
1050189109 9:3006576-3006598 GCCTGACCTTCATCACTGACTGG - Intergenic
1051032086 9:12693518-12693540 GCCAAAACTCCATTAGTGTAAGG + Intronic
1052564499 9:30130651-30130673 GCCTGAACACCTTTACTGAAAGG - Intergenic
1058956248 9:109951515-109951537 GCCTGAAGTCCGCTAGTGGCAGG - Intronic
1059108800 9:111535127-111535149 TCCTGTACTCCATCATTGACTGG + Intronic
1189727107 X:43978187-43978209 GCATTAACTCCATTTGTAACAGG + Intergenic
1190178509 X:48171299-48171321 GGCTAAACTCCCTTGGTGACAGG + Intergenic
1199399467 X:147380363-147380385 GCCAGTACTCCATAAGTGCCAGG + Intergenic