ID: 1046978997

View in Genome Browser
Species Human (GRCh38)
Location 8:120315930-120315952
Sequence TGGGATACCCTGTGTAGAAC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 88}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046978997_1046979009 28 Left 1046978997 8:120315930-120315952 CCTGTTCTACACAGGGTATCCCA 0: 1
1: 0
2: 0
3: 6
4: 88
Right 1046979009 8:120315981-120316003 GCTCACCAGGCCAGAGGGTAAGG 0: 1
1: 0
2: 0
3: 16
4: 189
1046978997_1046979004 6 Left 1046978997 8:120315930-120315952 CCTGTTCTACACAGGGTATCCCA 0: 1
1: 0
2: 0
3: 6
4: 88
Right 1046979004 8:120315959-120315981 GTTGGTTCACCAGGACGTGATGG 0: 1
1: 0
2: 0
3: 1
4: 61
1046978997_1046979007 22 Left 1046978997 8:120315930-120315952 CCTGTTCTACACAGGGTATCCCA 0: 1
1: 0
2: 0
3: 6
4: 88
Right 1046979007 8:120315975-120315997 GTGATGGCTCACCAGGCCAGAGG 0: 1
1: 0
2: 0
3: 13
4: 135
1046978997_1046979003 -3 Left 1046978997 8:120315930-120315952 CCTGTTCTACACAGGGTATCCCA 0: 1
1: 0
2: 0
3: 6
4: 88
Right 1046979003 8:120315950-120315972 CCAGGAGGCGTTGGTTCACCAGG 0: 1
1: 0
2: 0
3: 7
4: 107
1046978997_1046979008 23 Left 1046978997 8:120315930-120315952 CCTGTTCTACACAGGGTATCCCA 0: 1
1: 0
2: 0
3: 6
4: 88
Right 1046979008 8:120315976-120315998 TGATGGCTCACCAGGCCAGAGGG 0: 1
1: 0
2: 0
3: 19
4: 117
1046978997_1046979006 15 Left 1046978997 8:120315930-120315952 CCTGTTCTACACAGGGTATCCCA 0: 1
1: 0
2: 0
3: 6
4: 88
Right 1046979006 8:120315968-120315990 CCAGGACGTGATGGCTCACCAGG 0: 1
1: 0
2: 0
3: 14
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046978997 Original CRISPR TGGGATACCCTGTGTAGAAC AGG (reversed) Exonic
900946556 1:5834277-5834299 TATGATACCCAGGGTAGAACTGG - Intergenic
904954001 1:34267807-34267829 TGGGATACCTCCTGTAGGACTGG - Intergenic
913416264 1:118611936-118611958 AGAGAGACACTGTGTAGAACAGG - Intergenic
913554006 1:119946249-119946271 TGGGAGAGTTTGTGTAGAACTGG - Intronic
915243283 1:154539218-154539240 TGGGATTCCTGGTGTAGAAGAGG + Intronic
915398291 1:155602911-155602933 TTGGATACCCTGTCTAGACCAGG + Intergenic
915414213 1:155728108-155728130 TTAGATACCCTGTCTAGACCAGG + Intronic
916504262 1:165413738-165413760 TGGCAGACCCTGTATAGGACTGG - Intronic
917376782 1:174357012-174357034 TTGTATACTCTGTGTAGTACTGG + Intronic
918739236 1:188106262-188106284 TGGGACACCCTGTAAAGAAATGG - Intergenic
918805594 1:189037557-189037579 TGTGAGACTTTGTGTAGAACAGG + Intergenic
920909110 1:210197645-210197667 TGGGATACGGTGTGTACACCAGG - Intergenic
1065681133 10:28233843-28233865 TGGGGTACCCTGTGTTGCCCAGG - Intronic
1065721960 10:28636012-28636034 TAGGGTACCCTGTGCAGAACCGG - Intergenic
1071787177 10:88914637-88914659 TGGAATACTCTGTGGAAAACTGG + Exonic
1072905867 10:99453074-99453096 AGGGAAACCCTGAGTAGAACAGG - Intergenic
1073571051 10:104581483-104581505 TGGGATGCTCTGTGAGGAACAGG + Intergenic
1076207702 10:128616273-128616295 TGGTATAGCCTGTGTGGAAGGGG - Intergenic
1078957140 11:16211713-16211735 TGTGAGACACTGTGGAGAACAGG - Intronic
1080058414 11:27931643-27931665 TGGGACACCCTGGGAAAAACAGG - Intergenic
1080252522 11:30250287-30250309 TAGGATCCCCTGTGTTGACCAGG - Intergenic
1090407974 11:126488770-126488792 GGGGATCCCCTGTGGGGAACAGG - Intronic
1090534317 11:127624184-127624206 TGGGATTCCCAGTGTAGAGGTGG + Intergenic
1096465902 12:51847782-51847804 TGCGAATCTCTGTGTAGAACAGG + Intergenic
1107228489 13:38080169-38080191 TGGAATACCTTGAGTAGCACTGG - Intergenic
1108400483 13:50037194-50037216 TAGGAAACCCAGTGTAGAACTGG - Intergenic
1109126900 13:58529043-58529065 TGAAATACCCTGTCTAGAAAAGG + Intergenic
1110236426 13:73222100-73222122 TGGGACACCCTGTGTTGCCCAGG - Intergenic
1110317068 13:74121317-74121339 TGGAATACTTTGTGTAGAATTGG - Intronic
1114697494 14:24640551-24640573 TGGGATACACAGTGGAGCACAGG - Intergenic
1119833739 14:77727942-77727964 TGGAATAGTCTGAGTAGAACTGG + Intronic
1126040096 15:44582163-44582185 TGGAAAACATTGTGTAGAACTGG - Intronic
1126554977 15:49976522-49976544 TGGGAAAGCCAGTGCAGAACAGG + Intronic
1136280444 16:29205747-29205769 TGGGTTACCCTGGGGAGAAACGG + Intergenic
1138717936 16:59045767-59045789 TGGGATTTCCAGTGTAGAATAGG + Intergenic
1141289012 16:82700286-82700308 TGGGATGCCCTGTGAACAAAAGG - Intronic
1142228552 16:88888859-88888881 TGGGATCCCCTGTGTACCAAGGG + Intronic
1143251752 17:5528047-5528069 TGGAATACCCTGGTTAGAGCAGG + Intronic
1145805015 17:27720438-27720460 TGGGATGTCCTGTTTAGAAGAGG + Intergenic
1155800873 18:30102203-30102225 TGGGAAATCCTGGGTAGAAGAGG + Intergenic
1156445945 18:37236844-37236866 TCTGAGACCCTGTGTAGGACGGG + Intergenic
1156572382 18:38271744-38271766 TGGGATACTTTGAGTAGAATCGG + Intergenic
1202640044 1_KI270706v1_random:74336-74358 TGGGATAGGCTGTGGAGAAAAGG - Intergenic
938206949 2:129432040-129432062 TGGGCCACCCTGTGAAGAAAAGG - Intergenic
942712203 2:178849274-178849296 TGGGATCCACTTTGTAGATCAGG + Intronic
1172649009 20:36490047-36490069 TGGGTTACCCTGTGTTGGCCAGG + Intronic
1175388988 20:58614569-58614591 TGGGTCACCCTGTGAAGAAAGGG - Intergenic
1177723873 21:24942515-24942537 TTGTCTACCCTATGTAGAACTGG - Intergenic
1180361896 22:11907563-11907585 TGGGATAGGCTGTGGAGAAAAGG + Intergenic
1183163549 22:36130954-36130976 TGGGATTTCCTGTGAAGAAAAGG - Intergenic
1184529059 22:45042868-45042890 AGGGAGACCCTGGGAAGAACAGG + Intergenic
949094273 3:67236-67258 TGGCAAACCCTATGTAGAAGGGG + Intergenic
949467789 3:4361704-4361726 TCTGATACCCTTTTTAGAACTGG + Exonic
950680122 3:14579594-14579616 TGGGAGACTCTCAGTAGAACTGG - Intergenic
951271707 3:20632902-20632924 TGGGAAAAACTGGGTAGAACAGG - Intergenic
961014499 3:123457250-123457272 TGGGAGACACTGAGTAGAAGAGG + Intergenic
966907899 3:184541116-184541138 TGGCCCACCCTGGGTAGAACTGG + Intronic
968498277 4:931308-931330 TGTGATTCCGTGTGTAGTACAGG - Intronic
968735434 4:2292747-2292769 TGGAAGAGCTTGTGTAGAACGGG - Intronic
970187638 4:13478054-13478076 TGAGATTCTCTGTGTACAACTGG + Intronic
974400578 4:61400517-61400539 TGGGATTCCCTGTGAATAACTGG + Intronic
975366363 4:73533911-73533933 TAGGATAGCCTGTTTAGAGCAGG - Intergenic
979552421 4:122005835-122005857 TGGGATAACCTGGGTATTACAGG + Intergenic
984475220 4:180226867-180226889 GTGGATACCCTGTGTACCACAGG + Intergenic
986706051 5:10455608-10455630 TGTGATATCCTGTGCAGGACAGG - Intronic
988776461 5:34481977-34481999 TGGGAAACACTGGGTAGAAGAGG + Intergenic
999237802 5:150109395-150109417 TGGGATGCCCTGTCTAGATGTGG + Intronic
1001831968 5:174796612-174796634 TGGGATGCCCCGTGTAGATAGGG - Intergenic
1002621607 5:180492398-180492420 TGGGATACTCTGTACAGCACAGG + Intergenic
1004510887 6:16283856-16283878 TGTGAAACACTGTGTAGAGCTGG + Intronic
1004895015 6:20139936-20139958 TGGGGAACCCTGTGTATACCAGG - Intronic
1007142120 6:39586645-39586667 TGAAATAACCTGTATAGAACTGG + Intronic
1008454696 6:51695982-51696004 TGGGAGCCCCAGTGTGGAACAGG - Intronic
1009300947 6:62019499-62019521 TGGTATATCTTGTGTAGAATTGG + Intronic
1011529656 6:88307356-88307378 TGGAATAGAGTGTGTAGAACTGG + Intergenic
1016235048 6:141854538-141854560 TGGGAAACTATGTGTAGAAAAGG + Intergenic
1016686009 6:146883095-146883117 TGGGATGCCCCTTGGAGAACAGG + Intergenic
1019403145 7:867880-867902 TGGGAAAGCCTGTGCACAACAGG + Intronic
1033041597 7:137924167-137924189 TGGCCCACCCTGTGTAGACCTGG + Intronic
1040570426 8:48604305-48604327 TGTGCTGGCCTGTGTAGAACAGG + Intergenic
1046978997 8:120315930-120315952 TGGGATACCCTGTGTAGAACAGG - Exonic
1047429413 8:124777964-124777986 TGGGATGCGCTGTGCTGAACTGG + Intergenic
1050153507 9:2641416-2641438 TGGGATACACTGAGTAGAATGGG - Exonic
1054929285 9:70619271-70619293 CCGGATACCATGTATAGAACTGG + Intronic
1056261590 9:84854270-84854292 TGGGTTACACTGTGGACAACTGG - Intronic
1058568329 9:106311163-106311185 TGGCATAACCTGGGTAGGACTGG + Intergenic
1062252594 9:135605730-135605752 TGGGATTCCCTGGGTGGAAGAGG + Intergenic
1062361729 9:136191513-136191535 TGGGATGCCCTGGGCAGAAAAGG - Intergenic
1187983144 X:24780859-24780881 TGGGAGAGTTTGTGTAGAACTGG + Intronic
1189409467 X:40757010-40757032 TGTGTTGCCCTGTGGAGAACTGG - Intergenic
1192266168 X:69539296-69539318 TGGGCTGCCCTGAGTAGAAGAGG + Intergenic
1193274960 X:79575270-79575292 TTGGAATCCCTGTGTAGAATCGG + Intergenic
1196438726 X:115697564-115697586 TGGGGAACTCTGTGTACAACAGG + Intergenic
1196732793 X:118957983-118958005 TGGGATACTTTGTGATGAACTGG - Intergenic
1199018209 X:142845184-142845206 TGTGATACCTTGGGTAGAAATGG - Intergenic