ID: 1046980785

View in Genome Browser
Species Human (GRCh38)
Location 8:120334255-120334277
Sequence TTGTATGTGCATAACCTGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 98}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046980785 Original CRISPR TTGTATGTGCATAACCTGTA TGG (reversed) Intronic
902035631 1:13456118-13456140 TTGGATGGGCTAAACCTGTAGGG - Intergenic
909572308 1:77129217-77129239 TTGTATATGCATACCCTTGATGG - Intronic
911554525 1:99327368-99327390 ATGTGTGTGCATAACCTTTAAGG + Intergenic
912397709 1:109359942-109359964 TTGGAAGTGCATAACTTGTTTGG - Intronic
913472694 1:119205282-119205304 TTCCATGTGCATAACCAATAAGG - Intergenic
917198738 1:172493776-172493798 ACGTTTGTGCAAAACCTGTATGG - Intergenic
919309316 1:195887080-195887102 TTGCATCAGCATCACCTGTAGGG + Intergenic
921592163 1:217016894-217016916 TTGCATGAGGATAAACTGTATGG - Intronic
1065332855 10:24621003-24621025 TTCTATGTGAAGGACCTGTATGG + Exonic
1069762145 10:70818589-70818611 TCGTAGTGGCATAACCTGTAAGG + Intronic
1072156964 10:92732527-92732549 TTTATTGTGCCTAACCTGTAGGG + Intergenic
1075133650 10:119763040-119763062 TTCTAAGTACATAACTTGTATGG - Intronic
1079522479 11:21344549-21344571 CTGTATGTGCATAACATAAAAGG + Intronic
1079873584 11:25830236-25830258 TTGTAACTGCATAACAAGTATGG + Intergenic
1080414363 11:32055662-32055684 TAGTATTTTAATAACCTGTATGG - Intronic
1081142393 11:39517578-39517600 TTTTATTTGCTTAACCTATAAGG + Intergenic
1086944680 11:92833160-92833182 TTGTATTTTCATAGACTGTATGG + Intronic
1090472579 11:126993381-126993403 TTGTATTTGCATACACTGTAAGG + Intronic
1091901352 12:4146531-4146553 TTTCATGTGCAAAACCTGTGAGG + Intergenic
1094600736 12:31906878-31906900 TTGATGGTGCAAAACCTGTAGGG - Intergenic
1097132970 12:56827050-56827072 GTGTATGTGTGTAACCTTTAAGG + Intergenic
1100182859 12:92104406-92104428 TTATTTGTGTATAAACTGTAAGG - Intronic
1100401573 12:94234838-94234860 TTGAATGTGTAGAACCTTTATGG + Intronic
1106084581 13:26529479-26529501 TTGTATGTATATAACTTTTATGG + Intergenic
1111421964 13:88023071-88023093 ATGTATTTGCATGAACTGTAAGG - Intergenic
1112859191 13:103809083-103809105 TTGTATGTTCATAACCTTTCGGG - Intergenic
1129783787 15:78293937-78293959 TTGTATGTGCAGACCCAGTGTGG + Intronic
1132015814 15:98315575-98315597 TTGTCTGTGCTAAACCTCTAAGG - Intergenic
1133479457 16:6155938-6155960 TGATAAGTGCTTAACCTGTAGGG + Intronic
1133538321 16:6723515-6723537 TTGTATGTGCATAACATTTCTGG + Intronic
1137515683 16:49141525-49141547 TTTTTTGTGCATGACCTGCATGG - Intergenic
1138905315 16:61324396-61324418 TTGTATGTGCATCACCCGAATGG + Intergenic
1150247581 17:63687993-63688015 CTGTGTGTGCCTAATCTGTAGGG + Intronic
1156151777 18:34251540-34251562 TTGCTTGTGCATGACTTGTAGGG + Intergenic
1156669605 18:39452486-39452508 TTCAATGTGCATAACCTGACAGG - Intergenic
1158942258 18:62415779-62415801 TTGTATATGCATAGCCTTGATGG - Intergenic
1163823017 19:19507108-19507130 TTTTTTGTGCATAACTTGGATGG + Exonic
1164551998 19:29219587-29219609 TTGTGTGTGCAGACCCTGCAGGG - Intergenic
1165978554 19:39699241-39699263 TTGTATTTGAATAACCTACAGGG + Intergenic
925563224 2:5221121-5221143 CTGGAAGTGCATAACTTGTAAGG - Intergenic
931833743 2:66077883-66077905 TTTAATTTGCATAATCTGTATGG + Intergenic
937481384 2:122263592-122263614 TTATATGTGCACAACATGCAAGG - Intergenic
941409788 2:165140437-165140459 TTGTATGGGAATTACTTGTAAGG - Intronic
943244932 2:185434799-185434821 TTGTAAGTCCAAAATCTGTAGGG + Intergenic
943843477 2:192609506-192609528 TTATATGTCCACAACCTATAAGG + Intergenic
945804492 2:214473683-214473705 TTGTAAGTGTAAAACCTGTCTGG - Intronic
946786342 2:223248152-223248174 TTCTATGTACATAGTCTGTAAGG + Intergenic
1169120390 20:3092538-3092560 TTCTATATGGAAAACCTGTACGG + Intergenic
1174803324 20:53583675-53583697 CTGTATGTGCAAAATCTCTAAGG - Intronic
1175580898 20:60098493-60098515 TTGTATTTGCATAAACTCTTTGG - Intergenic
1176728940 21:10470196-10470218 GTGTATATACATAACGTGTAGGG - Intergenic
1177865880 21:26512864-26512886 TTGGCTGTGCATAACCTGTGTGG + Intronic
1180015224 21:45077790-45077812 TTGTATGTTCATAATATGTGAGG + Intronic
1180561346 22:16616954-16616976 CTGTATGTGCAAAATCTCTAAGG + Intergenic
1183534310 22:38388048-38388070 CTGTATGTGCAAAATCTCTAAGG - Intronic
1184659109 22:45957768-45957790 TTGTATGTGCCTAGCCCGCACGG + Intronic
953670823 3:44960378-44960400 ATACATGTGCATAACCTGTGAGG - Intronic
955989609 3:64612347-64612369 CTGTATCTGCATAACTTTTAGGG - Intronic
957142091 3:76373427-76373449 TTATATGTGCATAATTTGGATGG + Intronic
964664544 3:159157741-159157763 TTGTATGTGCATAAAGTGGAAGG - Intronic
970040297 4:11789240-11789262 TTGTGTGTGCATAATATGTATGG + Intergenic
973191353 4:47389343-47389365 TTCTAGGTGCATGAGCTGTAAGG + Intronic
978103254 4:104869563-104869585 TTATATCTGTATAACATGTAAGG - Intergenic
980609723 4:135142909-135142931 TTGTATGTGCACAGTCTCTATGG + Intergenic
981620248 4:146688536-146688558 TTGTATTTTCAAAATCTGTAGGG + Intergenic
983692192 4:170483524-170483546 ATGTATGTGCAAAACCCTTAAGG - Intergenic
985781243 5:1872897-1872919 ATGCATGTTCATAACATGTATGG - Intergenic
988292550 5:29308028-29308050 TTGTATGTACATAAGTTCTATGG - Intergenic
988367984 5:30326614-30326636 TTGAATGTGCAAGACATGTATGG + Intergenic
990798707 5:59574327-59574349 TTATATGTGCATAACTTATAGGG - Intronic
990801652 5:59610986-59611008 TTGTATGTGAATCCTCTGTAAGG - Intronic
993070741 5:83160391-83160413 TTGTATGTGCAGTATCTGTTTGG + Intronic
993269615 5:85777417-85777439 TGGAATGTGCATAAACTGTGTGG + Intergenic
994177386 5:96725814-96725836 TTATATTTGCATAAACTGAAAGG + Intronic
994724398 5:103417113-103417135 TAGAATGTGAATAACCTTTAGGG + Intergenic
999288467 5:150408120-150408142 TTGTATGTGCTTACCAAGTAAGG + Intronic
1001917989 5:175577451-175577473 TTTTAGGTTGATAACCTGTATGG - Intergenic
1008130681 6:47717394-47717416 TTGTCTCTGCATAACCGGCAAGG - Intronic
1008829686 6:55742620-55742642 TTGCATGTATATAGCCTGTAAGG - Intergenic
1009733422 6:67640704-67640726 GTGTATGTGCATAAATTGTCTGG - Intergenic
1009792867 6:68425829-68425851 TTATATTTGCATAACCTTTTGGG - Intergenic
1010791392 6:80069265-80069287 TTCTATGTGAAGGACCTGTATGG + Intergenic
1011872565 6:91914503-91914525 TTTTATGTGCTTAAGCTTTATGG + Intergenic
1014940734 6:127435745-127435767 TTGTATGTGCATACCCTTGATGG - Intergenic
1018958134 6:168426825-168426847 TTGTGTGTGTATAACGTATATGG - Intergenic
1020211501 7:6161409-6161431 TTGTATCTGAATAATCTGTATGG + Exonic
1023193123 7:37604357-37604379 TTGGATGTGCAGCACCTGTGGGG - Intergenic
1024580999 7:50800734-50800756 TAGTATTAGCATAACCTGCACGG + Intergenic
1026132117 7:67629465-67629487 TTTTGTCTACATAACCTGTAAGG + Intergenic
1032808004 7:135377519-135377541 TAGTATGTGAATATACTGTAAGG - Intronic
1033514582 7:142093501-142093523 TACAATGTGCACAACCTGTACGG + Intronic
1036236356 8:7042723-7042745 TAGTTTTTGCATAACTTGTAAGG + Intergenic
1037041628 8:14243536-14243558 ATTTATGTTCATAACATGTAAGG + Intronic
1037929417 8:22868975-22868997 TGGTATCTGCAGATCCTGTAGGG - Intronic
1039391880 8:37187740-37187762 TGGCATGTTCATAACCAGTAGGG + Intergenic
1039417081 8:37404643-37404665 TTGTATGTGCATACCTTACAGGG - Intergenic
1040719525 8:50301055-50301077 TTGTATGTGCTTATCCTATTTGG + Intronic
1046980785 8:120334255-120334277 TTGTATGTGCATAACCTGTATGG - Intronic
1059915618 9:119096442-119096464 TTGTAGGTGAATAAACTGAAAGG - Intergenic
1060120535 9:120985116-120985138 TTGTATTTGCTTTACCTTTAGGG - Intronic
1185701869 X:2236774-2236796 TTGTATGAGCAATTCCTGTATGG + Intronic
1190545836 X:51525366-51525388 CTGTATCTCCAGAACCTGTAAGG - Intergenic
1194056949 X:89146696-89146718 TTGGACGTGCATAATATGTAGGG + Intergenic
1194499456 X:94661964-94661986 TTATCTGTGCATAACTTGTCAGG + Intergenic
1196142966 X:112285534-112285556 TTGGATGTCCATTTCCTGTAGGG - Intergenic
1199043277 X:143139486-143139508 TTGCATCAGCATAACCTGGATGG + Intergenic
1199199788 X:145074008-145074030 TTCTATTTGCTTAACCTTTACGG - Intergenic
1199854777 X:151751456-151751478 TTGTGTGAGCAAAACCTGCAGGG - Intergenic
1199906086 X:152232900-152232922 TTGAATTAGCATAACCTCTATGG - Intronic
1202085642 Y:21133756-21133778 TTGTATGTTCATTTCATGTAAGG - Intergenic