ID: 1046984096

View in Genome Browser
Species Human (GRCh38)
Location 8:120368561-120368583
Sequence TTTTCAACACTGTTGGAACC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046984093_1046984096 -2 Left 1046984093 8:120368540-120368562 CCATTATAGTTGAAGAATGCCTT 0: 1
1: 0
2: 0
3: 14
4: 224
Right 1046984096 8:120368561-120368583 TTTTCAACACTGTTGGAACCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046984096 Original CRISPR TTTTCAACACTGTTGGAACC CGG Intronic
No off target data available for this crispr