ID: 1046991833

View in Genome Browser
Species Human (GRCh38)
Location 8:120466552-120466574
Sequence AGCACTAGATTTCAAAGAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 3, 3: 12, 4: 183}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046991833_1046991838 5 Left 1046991833 8:120466552-120466574 CCAGTTCTTTGAAATCTAGTGCT 0: 1
1: 0
2: 3
3: 12
4: 183
Right 1046991838 8:120466580-120466602 ACTTGGGTTTCAGCTGGGCGCGG No data
1046991833_1046991836 -1 Left 1046991833 8:120466552-120466574 CCAGTTCTTTGAAATCTAGTGCT 0: 1
1: 0
2: 3
3: 12
4: 183
Right 1046991836 8:120466574-120466596 TTTATAACTTGGGTTTCAGCTGG No data
1046991833_1046991837 0 Left 1046991833 8:120466552-120466574 CCAGTTCTTTGAAATCTAGTGCT 0: 1
1: 0
2: 3
3: 12
4: 183
Right 1046991837 8:120466575-120466597 TTATAACTTGGGTTTCAGCTGGG No data
1046991833_1046991839 8 Left 1046991833 8:120466552-120466574 CCAGTTCTTTGAAATCTAGTGCT 0: 1
1: 0
2: 3
3: 12
4: 183
Right 1046991839 8:120466583-120466605 TGGGTTTCAGCTGGGCGCGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046991833 Original CRISPR AGCACTAGATTTCAAAGAAC TGG (reversed) Intronic
901047187 1:6404123-6404145 AGCACTTGACTTTAAAGATCAGG - Intergenic
901721191 1:11199304-11199326 AGCACTACACTACAAAGAACTGG - Exonic
906121189 1:43392237-43392259 AACACTAGATTTTAAAGACTTGG - Intronic
907825160 1:58009240-58009262 AGCACTAGGTTTACAAGGACTGG - Intronic
908603323 1:65765003-65765025 AGCACTAGATTTCAAAGATTTGG - Intergenic
910309751 1:85810047-85810069 AGCACTTGTTTTCCAAGAACTGG + Intronic
915863467 1:159472746-159472768 AGAGATAAATTTCAAAGAACTGG + Intergenic
917507035 1:175636688-175636710 AGCACTGGAATTCTAAGGACAGG - Intronic
917772430 1:178294322-178294344 AGCAGTGGTTTTCAAAGAAGTGG - Intronic
918852175 1:189706638-189706660 AGAACTAGAATTCAAAGGAGCGG + Intergenic
920318630 1:205099067-205099089 TGCACCAGACTTCAAAGAATTGG - Exonic
923751297 1:236748568-236748590 AGCACAAGATTTCAAGCAACAGG - Intronic
1063365907 10:5490790-5490812 AGAAGCAGCTTTCAAAGAACTGG + Intergenic
1064907097 10:20358571-20358593 AGCACTGTATGTGAAAGAACAGG - Intergenic
1065197990 10:23285599-23285621 CACACTAGATTTCAAAGACTTGG - Intronic
1066635840 10:37498914-37498936 AATACTAGATTTCAAAGAATAGG + Intergenic
1067118388 10:43453188-43453210 ATCACTACATTTCAAAGCAATGG + Intronic
1067349912 10:45466242-45466264 AGGACTAAATGTCAGAGAACAGG - Intronic
1067700927 10:48571428-48571450 GGCACTATATTTTCAAGAACAGG - Intronic
1070704169 10:78625472-78625494 AGCTCTGGAATACAAAGAACAGG - Intergenic
1070845473 10:79519454-79519476 AGCACTAGATTTACAAGTATTGG + Intergenic
1070928320 10:80240860-80240882 AGCACTAGATTTACAAGTATTGG - Intergenic
1070989903 10:80722271-80722293 AGTCCTAGACATCAAAGAACTGG - Intergenic
1074030237 10:109680016-109680038 ATCACCACATTTCAAAGATCAGG + Intergenic
1074652426 10:115539451-115539473 AACACCAGAATTCAAAGTACTGG + Intronic
1074733377 10:116401350-116401372 AACACTAGATTGCATAGCACTGG + Intergenic
1075451323 10:122553655-122553677 AGCACTGGTTCTCAAAGCACAGG - Intergenic
1078319987 11:10325863-10325885 AGCATTACATTTCTCAGAACGGG + Intronic
1079319025 11:19434939-19434961 AAGAAAAGATTTCAAAGAACTGG - Intronic
1080517629 11:33039081-33039103 AAAATTAAATTTCAAAGAACGGG + Intergenic
1083248067 11:61445339-61445361 AGAACCAGATTTCAGTGAACGGG - Intronic
1085953776 11:81366135-81366157 TCCACTAGACTTCAAATAACAGG - Intergenic
1086060495 11:82695216-82695238 AGGACCAGATCTCAAAGACCTGG - Intergenic
1086823782 11:91470245-91470267 TGCAGGAAATTTCAAAGAACAGG - Intergenic
1088024609 11:105162756-105162778 AGCACTAGAGCACAAGGAACAGG - Intergenic
1089115041 11:116087980-116088002 AGTCCTGGATTTCAAGGAACTGG + Intergenic
1093563115 12:20566646-20566668 AGCTCTAGTTCTCAAAGGACTGG + Intronic
1095316186 12:40764525-40764547 ATGACTACATTTCAAAGAAATGG + Intronic
1095359920 12:41324773-41324795 AGTGCTAGATTTCAAAGAGTTGG + Intronic
1098196636 12:68008897-68008919 GGCAGTAGATTTCAGTGAACAGG + Intergenic
1098673374 12:73257374-73257396 AACACTGCACTTCAAAGAACTGG + Intergenic
1104317335 12:127715845-127715867 AGCACTGGATCAAAAAGAACTGG + Intergenic
1111430044 13:88137675-88137697 AGCACATGATTTCAAAAGACAGG + Intergenic
1111924605 13:94449096-94449118 AACACTAAATTTCAAAGTAGAGG + Intronic
1113292210 13:108919495-108919517 AGGAGAAGATGTCAAAGAACCGG - Intronic
1115812685 14:37127494-37127516 AGCACTAGAAGTCAAAGATAAGG - Intronic
1117487142 14:56209845-56209867 GCCACTGGTTTTCAAAGAACTGG + Intronic
1117844458 14:59896376-59896398 AACAGAAGAATTCAAAGAACAGG + Intergenic
1118809948 14:69265840-69265862 ACCACAAGATTTCAGAGAAGAGG - Intronic
1119027207 14:71163627-71163649 AGCAATAGAGTTCAGAGAAGGGG - Intergenic
1119573115 14:75693844-75693866 ATGACTAGATTTCAAAGCAATGG + Intronic
1120037937 14:79719127-79719149 AGCATAAGATTTCAAACAAAGGG - Intronic
1120519592 14:85511190-85511212 AGTAATAGACTTCAAAGGACTGG + Intergenic
1120546081 14:85813094-85813116 AGCACTAGATTTTAAACGACAGG + Intergenic
1124126120 15:26939346-26939368 TGCCCCCGATTTCAAAGAACAGG + Intronic
1127704294 15:61531973-61531995 AGCACTATATTTTAAAGAAAAGG - Intergenic
1131479656 15:92769934-92769956 AGCATTAAATTTCATACAACTGG - Intronic
1133749858 16:8716205-8716227 AGTACTAAATTTCACAAAACAGG - Intronic
1135358980 16:21794975-21794997 AGCATTAGAGTTCTGAGAACAGG - Intergenic
1135457534 16:22611411-22611433 AGCATTAGAGTTCTGAGAACAGG - Intergenic
1141772596 16:86099876-86099898 AGGTCTAGATTTCAAAGACTTGG + Intergenic
1141872799 16:86800007-86800029 AGCACCTGATTTCAACAAACAGG - Intergenic
1144196228 17:12897740-12897762 AGCACTATTTTTAAAATAACTGG + Intronic
1146614311 17:34340940-34340962 AGCACTAAAATTCATAAAACAGG - Intergenic
1147796146 17:43044707-43044729 AGCAGAAGATTTTCAAGAACCGG - Intronic
1148024305 17:44575403-44575425 AGCACTAGAAATAAAAGAATGGG - Intergenic
1149205198 17:54236102-54236124 AGCACTGTATTTGACAGAACAGG + Intergenic
1149598707 17:57879495-57879517 CTCAGTATATTTCAAAGAACAGG - Intronic
1149728394 17:58920699-58920721 AGCATTAGATATCCAAGAGCAGG + Intronic
1151442905 17:74145120-74145142 AGCACAAGTTTAAAAAGAACTGG + Intergenic
1158815919 18:61096752-61096774 ATCAATAAATTTCATAGAACTGG + Intergenic
1159316999 18:66788346-66788368 AGGATTACATTTCAAAGAAATGG - Intergenic
1165558590 19:36658179-36658201 AGGGCTAGCTTTCAAATAACTGG - Intronic
1167680738 19:50918793-50918815 TACACTGGATTTCGAAGAACTGG + Intergenic
926495668 2:13583816-13583838 AGCACTGGAATTCTAGGAACAGG + Intergenic
927034058 2:19154295-19154317 AGAACTAAAATTCAAAAAACTGG + Intergenic
929037666 2:37710250-37710272 AGAAATAGATTTCAAAAACCAGG + Intronic
931101028 2:59001176-59001198 AGTTCTAGACTTCAAAGAAAAGG - Intergenic
931230993 2:60374806-60374828 AGCACAAGATATGAAAGGACAGG - Intergenic
933328193 2:80864583-80864605 ATCACTAGATTTCTAAAAATGGG + Intergenic
935671927 2:105563311-105563333 AAAACTAGATTTCAAAGCAGAGG + Intergenic
937825449 2:126364180-126364202 AGCACTAGATGTGAAAGAGGAGG + Intergenic
941332018 2:164190144-164190166 GGGGCTAGATTTCAAAGAAAGGG + Intergenic
943499401 2:188668180-188668202 AGAACTAGATTTCAAAGGACTGG + Intergenic
944939949 2:204613363-204613385 ATCATGAAATTTCAAAGAACTGG - Intronic
945277512 2:208002734-208002756 AACACTAGATTACCAAGACCAGG + Intronic
945427888 2:209729878-209729900 AAAACTAGATTTCAAAGAAAAGG + Exonic
1171002948 20:21433321-21433343 AGCACCAGATTCCAAAAAGCTGG + Intergenic
1171074656 20:22110394-22110416 AGAACTAGATTTCAGAGTATTGG - Intergenic
1171429093 20:25068884-25068906 AGAAATAGATTTAAAAGAAAGGG + Intergenic
1175370405 20:58484546-58484568 AACAATAGATTTCAAATAATAGG - Intronic
1175456878 20:59122146-59122168 AGCAAAAGACTACAAAGAACAGG + Intergenic
1175470885 20:59226854-59226876 AGGACTAAATCTCAAAGAGCTGG - Intronic
1177005170 21:15663676-15663698 AGCTCTAGAGTTTAAAGAAAAGG + Intergenic
1182411288 22:30189164-30189186 AGAACTAGTTTTCAAAACACTGG - Intergenic
949100790 3:142568-142590 AGCAATAGATTTTAAACAATTGG - Intergenic
952504247 3:33993639-33993661 AGCTGCAGATTTCAAAGAATGGG - Intergenic
954237894 3:49270992-49271014 AGCAATGGAATTCAAAAAACTGG + Exonic
956893199 3:73633201-73633223 AGGACACGATTTCAAAGAACAGG - Intergenic
957146180 3:76426732-76426754 ATTAGTAGATTTCAAAGAAAGGG + Intronic
957744505 3:84321522-84321544 AGCACGATACTCCAAAGAACAGG - Intergenic
959677164 3:109049531-109049553 AGCATTAGATTCCAAAAAAAAGG + Intronic
959834756 3:110905340-110905362 AGGCTGAGATTTCAAAGAACTGG + Intergenic
961483869 3:127203429-127203451 ATCTATAAATTTCAAAGAACTGG - Intergenic
962447311 3:135478701-135478723 AACACAAGACTTCAAGGAACAGG - Intergenic
962865104 3:139442023-139442045 AGCACTACATTTCATAGTGCAGG - Intergenic
963294733 3:143533298-143533320 AGCACTAGATGTGGAAGACCTGG - Intronic
964207878 3:154195027-154195049 ATCACTGCATTTCCAAGAACTGG - Intronic
964434493 3:156637261-156637283 AGCCATAGAATTCATAGAACAGG + Intergenic
964812257 3:160678473-160678495 AGCAATAGATTTCAAAAAGCTGG - Intergenic
965446944 3:168785292-168785314 AGCACAATATTGCAAAGAAGTGG - Intergenic
965778480 3:172258370-172258392 AGAATTAGAATACAAAGAACCGG - Intronic
967166748 3:186786774-186786796 AGCACTAGATTGTAAAGACTGGG + Intronic
967224236 3:187275633-187275655 AGAACTGGTTTTCATAGAACTGG - Intronic
969695992 4:8735190-8735212 AGCAAGAGACCTCAAAGAACTGG + Intergenic
971643640 4:29167135-29167157 AGTAATAGATCTCAAAGAAAAGG + Intergenic
974438592 4:61888043-61888065 AACAGTAAATTTCAAAGGACAGG + Intronic
975949829 4:79756667-79756689 ACCACTAGATTTCATAGCATAGG - Intergenic
977059990 4:92246037-92246059 TACACCAGATTTCAAAGAATTGG + Intergenic
977827196 4:101547224-101547246 TGAACCAGTTTTCAAAGAACTGG + Intronic
978643597 4:110901355-110901377 AGCACTGGGTTTAAAAGCACAGG - Intergenic
980468923 4:133224679-133224701 AGCACTGGATGTCAAAGATCTGG + Intergenic
980836471 4:138199675-138199697 AGCACTATCTTTTAGAGAACAGG + Intronic
981269731 4:142831195-142831217 AGTACTAAATTCCAAAGAAATGG + Intronic
981621808 4:146709177-146709199 AGGACAAGATGTAAAAGAACAGG - Intronic
982538979 4:156643559-156643581 AGTACTGGATTTCACAGAAAAGG - Intergenic
984561328 4:181274128-181274150 AGCAGTAGATTTTACTGAACAGG - Intergenic
985079944 4:186254497-186254519 ATCACTCTCTTTCAAAGAACTGG - Intronic
985847490 5:2362088-2362110 AGCACTAAGTTTAAAAGAAGTGG + Intergenic
986612205 5:9580466-9580488 ATCAGTACATTTCAAAGAAGAGG - Intergenic
986686487 5:10279184-10279206 AGCAGTGGATTTCCAAGCACTGG - Intronic
986955573 5:13146314-13146336 AGGACAAGATCTCAAAGAAAAGG - Intergenic
987494516 5:18626868-18626890 AATACTGGATTTCAAAGAATAGG - Intergenic
989234216 5:39126397-39126419 AGGATTAAGTTTCAAAGAACTGG + Intronic
990183002 5:53183322-53183344 AGCAATGGATTTCAAAGAACAGG - Intergenic
991568166 5:68026677-68026699 AGCACAAGATTACTAAGAAAGGG + Intergenic
993498933 5:88641299-88641321 AGCACTTAATTTCCAAAAACAGG - Intergenic
993569585 5:89520729-89520751 AGTCCTAGATTTCAAGGAAAAGG + Intergenic
994686589 5:102961870-102961892 AGCACTACCTTCCAAACAACTGG - Intronic
995190782 5:109317371-109317393 AGAATTAGATTCCAGAGAACTGG - Intergenic
995364984 5:111348548-111348570 AGACCTATATTTCAAAGAATTGG + Intronic
995881369 5:116847943-116847965 AGTACTAGATTTCCCAGAATTGG - Intergenic
996148667 5:120008131-120008153 AGGACTAAATATCAAAGATCTGG - Intergenic
997910051 5:137862904-137862926 AACACAAGATTTTAAAGAAGTGG + Intergenic
998059555 5:139109146-139109168 AACAGTAGATTTCAAAGGAGAGG - Intronic
999422100 5:151453402-151453424 CACACTAGATTTCAATGAACTGG - Intronic
1000441800 5:161272342-161272364 AATACTAGGTTACAAAGAACTGG - Intergenic
1001337173 5:170808765-170808787 AACAGGAGATTTCTAAGAACTGG + Intronic
1001903974 5:175455451-175455473 AGCAATAGATTTTAAAGTAAGGG - Intergenic
1013441419 6:110174158-110174180 AGGAAGAGAATTCAAAGAACAGG - Intronic
1014429920 6:121356561-121356583 AGCAGAAGTTTTCAAATAACAGG + Intergenic
1015128515 6:129783355-129783377 AGCCCTAGAATTCAAAGAGATGG + Intergenic
1015564028 6:134547420-134547442 AGGAGTAAATGTCAAAGAACGGG + Intergenic
1018574777 6:165248365-165248387 AGCACAAGAGCTCAAAGAATAGG - Intergenic
1019201188 6:170317447-170317469 AGTAGTAAATTTCAAAGAACTGG + Exonic
1020134368 7:5578559-5578581 TTCACTGAATTTCAAAGAACTGG + Intergenic
1021929753 7:25568423-25568445 AGCAGTAGATTTAAAACAAATGG - Intergenic
1023131656 7:37009508-37009530 AGCACTAGATATCTATAAACTGG + Intronic
1023737757 7:43249466-43249488 AGCACTTACTTTGAAAGAACAGG - Intronic
1026433586 7:70372861-70372883 AGCACTACATTAAAAAGAAGAGG + Intronic
1027872780 7:83731301-83731323 AGGACTACATTTCAAAGACATGG + Intergenic
1027914492 7:84298433-84298455 AACATAAGATTTCAAGGAACTGG + Intronic
1029136451 7:98375827-98375849 AGCACTAGAGATAAAAGGACAGG + Intronic
1030288652 7:107850582-107850604 AGCAGTACATTTCCAAGCACGGG - Intergenic
1031086109 7:117303284-117303306 GGCATTACATTTCTAAGAACGGG + Intronic
1032684244 7:134215070-134215092 AGCACTACATTTAATAAAACAGG - Intronic
1033721919 7:144069523-144069545 ATCACTAGAAATTAAAGAACAGG + Intergenic
1033950833 7:146782293-146782315 AGCAGAAAAATTCAAAGAACTGG + Intronic
1038519657 8:28219539-28219561 AACACCAGATTTCAAAGACTTGG + Intergenic
1039055885 8:33536120-33536142 AGCCCTGGAATTCAAAGAATGGG - Intergenic
1041406548 8:57505696-57505718 TGCACTATTTTTCAAAGAAAGGG + Intergenic
1043045028 8:75312459-75312481 ACTGCTAGATTTCAATGAACTGG - Intergenic
1043344257 8:79281365-79281387 AACACAATAGTTCAAAGAACTGG - Intergenic
1044219550 8:89653271-89653293 AACATTATACTTCAAAGAACTGG + Intergenic
1046262257 8:111783802-111783824 AGCTATAGATTTCAAATCACAGG - Intergenic
1046991833 8:120466552-120466574 AGCACTAGATTTCAAAGAACTGG - Intronic
1048053644 8:130843593-130843615 AGCAATAGTTTTCAAGGCACTGG - Intronic
1048633108 8:136266031-136266053 AGCACCAGATATCACAGAAAGGG + Intergenic
1050301121 9:4259968-4259990 AGCCCTAGACTTCCAAGAAGTGG + Intronic
1053950307 9:43367531-43367553 AGCACTCCATTTCATAGAGCAGG + Intergenic
1054921431 9:70546606-70546628 AGCACAACATTTGATAGAACAGG + Intronic
1056715977 9:89029097-89029119 AGAACATAATTTCAAAGAACTGG + Intronic
1059716715 9:116920024-116920046 AGAACTAAATTGCAAAGAGCAGG - Intronic
1059794683 9:117680125-117680147 AGCAATAGATTTCACAGAGGTGG - Intergenic
1062503823 9:136862774-136862796 AGCTCCAGAATTCAGAGAACAGG + Intronic
1203725533 Un_GL000216v2:46596-46618 ATGAATAGATTTGAAAGAACTGG - Intergenic
1203593548 Un_KI270747v1:96754-96776 AGCACTCCATTTCATAGAGCAGG + Intergenic
1185728381 X:2441482-2441504 AGAAAGAGATTTTAAAGAACTGG + Intronic
1186899505 X:14038463-14038485 AGCACGAGATTGGATAGAACAGG + Intergenic
1188379277 X:29471393-29471415 AGGGTTAGATTTCATAGAACTGG + Intronic
1190070958 X:47278949-47278971 AACACTGGAGTTCAGAGAACTGG + Intergenic
1191192332 X:57679859-57679881 AGCACTAGAGTTTATAGAAACGG - Intergenic
1193393153 X:80953595-80953617 AGCAGAAGTTTTCAAAGAAAGGG - Intergenic
1194576874 X:95624130-95624152 AGCAGTAGATTTCATAGTAGAGG - Intergenic
1196327227 X:114420911-114420933 AGCAAGAGATTTTATAGAACGGG - Intergenic
1196805984 X:119586581-119586603 ATGACTACATTTCAAAGAAAGGG + Intergenic
1197985766 X:132265321-132265343 AACACTAGGTTGCAAAGAGCAGG - Intergenic
1198859663 X:141055704-141055726 AGCACTCGAGTTCAGAGAGCTGG + Intergenic
1198903030 X:141531686-141531708 AGCACTCGAGTTCAGAGAGCTGG - Intergenic