ID: 1046993353

View in Genome Browser
Species Human (GRCh38)
Location 8:120486642-120486664
Sequence AACCCTTTATTGGAAGCCGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046993350_1046993353 -9 Left 1046993350 8:120486628-120486650 CCATGAGATGCTGTAACCCTTTA 0: 1
1: 0
2: 0
3: 8
4: 480
Right 1046993353 8:120486642-120486664 AACCCTTTATTGGAAGCCGAGGG No data
1046993347_1046993353 2 Left 1046993347 8:120486617-120486639 CCTGCTCCTTCCCATGAGATGCT 0: 1
1: 0
2: 1
3: 20
4: 289
Right 1046993353 8:120486642-120486664 AACCCTTTATTGGAAGCCGAGGG No data
1046993349_1046993353 -8 Left 1046993349 8:120486627-120486649 CCCATGAGATGCTGTAACCCTTT 0: 1
1: 0
2: 1
3: 10
4: 101
Right 1046993353 8:120486642-120486664 AACCCTTTATTGGAAGCCGAGGG No data
1046993348_1046993353 -4 Left 1046993348 8:120486623-120486645 CCTTCCCATGAGATGCTGTAACC 0: 1
1: 0
2: 0
3: 11
4: 110
Right 1046993353 8:120486642-120486664 AACCCTTTATTGGAAGCCGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046993353 Original CRISPR AACCCTTTATTGGAAGCCGA GGG Intronic
No off target data available for this crispr