ID: 1046997467

View in Genome Browser
Species Human (GRCh38)
Location 8:120540269-120540291
Sequence GTTTAAGCAATCCTGGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046997467_1046997476 1 Left 1046997467 8:120540269-120540291 CCCACCTCCAGGATTGCTTAAAC No data
Right 1046997476 8:120540293-120540315 GACATAGGGGGTAGAGGAGAAGG No data
1046997467_1046997475 -5 Left 1046997467 8:120540269-120540291 CCCACCTCCAGGATTGCTTAAAC No data
Right 1046997475 8:120540287-120540309 TAAACAGACATAGGGGGTAGAGG No data
1046997467_1046997477 4 Left 1046997467 8:120540269-120540291 CCCACCTCCAGGATTGCTTAAAC No data
Right 1046997477 8:120540296-120540318 ATAGGGGGTAGAGGAGAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046997467 Original CRISPR GTTTAAGCAATCCTGGAGGT GGG (reversed) Intronic