ID: 1047009983

View in Genome Browser
Species Human (GRCh38)
Location 8:120661871-120661893
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047009982_1047009983 -3 Left 1047009982 8:120661851-120661873 CCAGATTTCTTAACAACTAAGTT 0: 1
1: 0
2: 0
3: 14
4: 281
Right 1047009983 8:120661871-120661893 GTTTATGTATGTTCAGAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr