ID: 1047010107

View in Genome Browser
Species Human (GRCh38)
Location 8:120663197-120663219
Sequence CCTCATCTGCAGATAGAAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047010104_1047010107 -4 Left 1047010104 8:120663178-120663200 CCTCTCTGCATCTGAGTTTCCTC 0: 1
1: 6
2: 80
3: 535
4: 2859
Right 1047010107 8:120663197-120663219 CCTCATCTGCAGATAGAAATGGG No data
1047010102_1047010107 14 Left 1047010102 8:120663160-120663182 CCCTGGAGAAAGAAATTACCTCT 0: 1
1: 0
2: 1
3: 30
4: 338
Right 1047010107 8:120663197-120663219 CCTCATCTGCAGATAGAAATGGG No data
1047010103_1047010107 13 Left 1047010103 8:120663161-120663183 CCTGGAGAAAGAAATTACCTCTC 0: 1
1: 0
2: 2
3: 9
4: 237
Right 1047010107 8:120663197-120663219 CCTCATCTGCAGATAGAAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047010107 Original CRISPR CCTCATCTGCAGATAGAAAT GGG Intronic
No off target data available for this crispr