ID: 1047012435

View in Genome Browser
Species Human (GRCh38)
Location 8:120686494-120686516
Sequence TGAGGTTAATACTTCATGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 1, 1: 0, 2: 3, 3: 13, 4: 236}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047012435_1047012437 -1 Left 1047012435 8:120686494-120686516 CCATTCATGAAGTATTAACCTCA 0: 1
1: 0
2: 3
3: 13
4: 236
Right 1047012437 8:120686516-120686538 ATGACCTAACTGCCTCCCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047012435 Original CRISPR TGAGGTTAATACTTCATGAA TGG (reversed) Intronic
907714011 1:56910985-56911007 ACATGTTAATACTTCATAAAAGG - Intronic
908439721 1:64141655-64141677 TGAGATTAATTCTAGATGAAAGG - Intronic
909294918 1:73935289-73935311 TGAGGTTCTGACCTCATGAATGG + Intergenic
911431402 1:97792462-97792484 TGAGGTCAATAGTTCAAGATCGG - Intronic
912392548 1:109314237-109314259 TGAGGCTATTTCTTCTTGAATGG - Intronic
915618956 1:157067093-157067115 TGAGGAAAAAACTTCCTGAAAGG - Intergenic
915781809 1:158560360-158560382 TGAGTTTAATACATGATTAATGG + Intergenic
916288142 1:163133139-163133161 TCAGGGGAATACCTCATGAATGG + Intronic
917282138 1:173387315-173387337 TGGGACTAATACTTCATAAAAGG + Intergenic
918712895 1:187753526-187753548 TAAAGTTATTACATCATGAATGG - Intergenic
920792710 1:209107862-209107884 TGAGGATAAAACAACATGAAAGG + Intergenic
920834594 1:209497985-209498007 TGAGGGGAATCCCTCATGAATGG - Intergenic
921441160 1:215187906-215187928 TGAGGTTAATATTTTGTAAAGGG + Intronic
922954797 1:229590023-229590045 TGAGGTTAAGAGTTCAAGACTGG + Intergenic
923205181 1:231752482-231752504 GGGGGTGGATACTTCATGAATGG - Intronic
923302487 1:232654694-232654716 TGAGGAAAATAGTGCATGAATGG + Intergenic
1068200187 10:53774207-53774229 GGAGGTGAATACTTCATGAATGG - Intergenic
1068580323 10:58731833-58731855 TCAGGTGGATCCTTCATGAACGG - Intronic
1070972249 10:80577357-80577379 GCAGGTTAATAATTCAGGAAGGG - Intronic
1071179895 10:82971169-82971191 GGGGGTTGATTCTTCATGAATGG - Intronic
1074604790 10:114950856-114950878 TGAGTTTAATACTTTGAGAATGG + Intronic
1076191507 10:128486706-128486728 TGGGGTGGATCCTTCATGAATGG - Intergenic
1077949393 11:6939704-6939726 TGACGGTAAAACTTCAAGAAGGG + Intronic
1079125752 11:17717846-17717868 CGAGGTGAGTACTTCATGAAGGG + Intergenic
1079662834 11:23062899-23062921 GGGGGTGAATACCTCATGAATGG - Intergenic
1079776248 11:24532874-24532896 TGATGTTATTTCTTGATGAAAGG - Intronic
1080581092 11:33644602-33644624 TGAGGATAATACTGCCTCAAAGG - Intronic
1080908003 11:36566200-36566222 TGAGGTCAATAATTTATAAATGG - Intronic
1081276294 11:41153285-41153307 TGAGTTGAATACTTTTTGAAGGG + Intronic
1081276577 11:41156936-41156958 TGAGGGCTCTACTTCATGAATGG + Intronic
1081535089 11:43990482-43990504 TGAGGGTTCCACTTCATGAATGG - Intergenic
1085122913 11:73978664-73978686 AGCAGTCAATACTTCATGAAGGG + Intronic
1085939793 11:81195346-81195368 GGAGGTGGATACTTCATGAATGG + Intergenic
1085975762 11:81652404-81652426 TGGGGTGAATCCCTCATGAATGG + Intergenic
1086911821 11:92480844-92480866 TGAAGTTATGATTTCATGAATGG + Intronic
1087110447 11:94461306-94461328 TGACGTTATTACTCCCTGAATGG - Intronic
1088925934 11:114302821-114302843 GGAGGTGGAGACTTCATGAATGG + Intronic
1092741189 12:11631631-11631653 TGAGGTTAATTATTCATTAAGGG + Intergenic
1093185910 12:16019895-16019917 GGAGGTAGATCCTTCATGAATGG + Intronic
1097478978 12:60097346-60097368 TGATGCTAATACTTCATAAGTGG + Intergenic
1100052074 12:90461029-90461051 AGGGGTGAATCCTTCATGAATGG - Intergenic
1100056364 12:90516162-90516184 TGCGGTTTAAACTTCATCAAGGG - Intergenic
1100431962 12:94538969-94538991 TGAGGTTGATACTGCATGATGGG - Intergenic
1102201783 12:111062506-111062528 TGAGATAAATACTTGTTGAATGG - Intronic
1102840718 12:116117646-116117668 TGTTTTTAATACTTTATGAATGG - Intronic
1105490376 13:20882473-20882495 TGAGGTGGATCCCTCATGAATGG - Intronic
1108883835 13:55155510-55155532 GGAGGTGCATCCTTCATGAATGG + Intergenic
1108917124 13:55628681-55628703 TAACTTTAATACTTCATTAAGGG - Intergenic
1109665403 13:65528444-65528466 TGTGCTTAAGACTTCAGGAAAGG - Intergenic
1110039571 13:70735943-70735965 TACAGTTAATACTGCATGAATGG - Intergenic
1112984037 13:105424057-105424079 TCAGGTTGTTACTTCATAAACGG - Intergenic
1113720909 13:112555553-112555575 TGAGATGAATACCTCATGGAGGG - Intronic
1117737282 14:58780682-58780704 TGAGGTTAGAACTACATGGAGGG + Intergenic
1118355604 14:65011126-65011148 TGAGGTAAAGACTACATGAAGGG + Intronic
1119070227 14:71575601-71575623 TGTGGTTAATACAGCATTAAAGG - Intronic
1119981486 14:79086624-79086646 TGAGGTCAGTATTTAATGAAAGG + Intronic
1121372813 14:93375778-93375800 TGGGGGTAATCCGTCATGAATGG - Intronic
1121451434 14:94010752-94010774 TGAGGTTTAGACTCCATCAAGGG + Intergenic
1121895475 14:97642997-97643019 TGTGGATAATACTTCAAGTAAGG + Intergenic
1125658046 15:41374419-41374441 GGAGGTAAATAGGTCATGAATGG - Intronic
1128089010 15:64906300-64906322 AGAGGTTAATACTTCACTCAGGG - Intronic
1130557408 15:84932367-84932389 TGAAGATAAAACTTCAGGAAGGG + Intronic
1131232881 15:90672222-90672244 TGAGATTACTACCCCATGAAAGG + Intergenic
1131364128 15:91823334-91823356 GGGGGTGGATACTTCATGAATGG + Intergenic
1133662311 16:7930233-7930255 TGAGGAAAATACTTCACTAAAGG + Intergenic
1136948090 16:34680293-34680315 TGGGGTTAGACCTTCATGAATGG - Intergenic
1137310130 16:47247309-47247331 AGATGTAAATTCTTCATGAAAGG + Intronic
1138912192 16:61414574-61414596 TTAGGTCATTAGTTCATGAAGGG - Intergenic
1139093458 16:63676781-63676803 TAAGGTAAAGACCTCATGAATGG + Intergenic
1140660696 16:77189522-77189544 GGGGGTGAATCCTTCATGAATGG + Intergenic
1140807653 16:78547779-78547801 TGAGGCAAAGCCTTCATGAATGG - Intronic
1143075711 17:4341248-4341270 TAAGTTTAATACTTTATAAAGGG - Intronic
1151129127 17:71877385-71877407 TGAGGTTAAAAGATCAGGAAGGG - Intergenic
1151838886 17:76603236-76603258 TGGGGTAGATCCTTCATGAATGG - Intergenic
1153020434 18:623889-623911 TGGGCTTAATACTCCAGGAAAGG + Intronic
1153224393 18:2887432-2887454 GGAGGTTGATCCTTCATGAATGG + Intronic
1153657678 18:7299405-7299427 TGGGGTGGATCCTTCATGAATGG + Intergenic
1157453460 18:47805215-47805237 TCAGGTGAATACTTCATGTCAGG - Intergenic
1157455529 18:47825338-47825360 TGAGGCAGATGCTTCATGAATGG + Exonic
1158878370 18:61753400-61753422 GGGGGTGAATCCTTCATGAATGG + Intergenic
1159564490 18:70033046-70033068 TGGGGTAGATCCTTCATGAATGG + Intronic
1165593181 19:36988593-36988615 AGGGGTGAATACTTCATGAATGG - Intronic
1165884361 19:39067113-39067135 TGGGGTGGATCCTTCATGAATGG - Intergenic
926668113 2:15547398-15547420 TGACCTTAATACTGCATTAATGG - Intronic
928386403 2:30872124-30872146 GGGGGTTAATCCCTCATGAATGG + Intergenic
928489969 2:31772241-31772263 TGAGGCTTATACTTCAAGACTGG + Intergenic
928719186 2:34099578-34099600 TGAGGCAAAGCCTTCATGAATGG + Intergenic
929034883 2:37681168-37681190 TGAGTTTCATGCTTCCTGAAGGG + Intronic
930020203 2:46997191-46997213 TGAGGTCAAGAGTTCATGACTGG - Intronic
933056436 2:77674183-77674205 TGAGTTCAATTTTTCATGAAAGG - Intergenic
933883155 2:86692093-86692115 TCAGGTTAATCCTTCATTTATGG - Intronic
933926508 2:87094944-87094966 TGAGTTCAATTTTTCATGAAAGG - Intergenic
934250358 2:90347927-90347949 TGAGGTTCGACCTTCATGAATGG + Intergenic
935873909 2:107485588-107485610 TGGGGTGAATCCCTCATGAATGG + Intergenic
936342173 2:111643406-111643428 TGAAGTTTATACTTAATGATGGG - Intergenic
936896384 2:117432572-117432594 TGAGGTGAAGCCCTCATGAATGG - Intergenic
937559744 2:123207299-123207321 TGATTTTAATACATCATCAAAGG + Intergenic
938960318 2:136335014-136335036 TGAGGGTGGTCCTTCATGAATGG - Intergenic
939599697 2:144173780-144173802 TGTGGCAAATCCTTCATGAATGG + Intronic
940022941 2:149174832-149174854 TGGGCTTAATACCTTATGAATGG + Intronic
941595167 2:167467303-167467325 TTGGGTTATTACTTCATGTAGGG + Intergenic
945084777 2:206119948-206119970 TGGGGCAAATCCTTCATGAATGG + Intronic
947249699 2:228088652-228088674 GGAGGTGAATCCCTCATGAATGG + Intronic
947956596 2:234197412-234197434 GGGGGTGAATCCTTCATGAATGG - Intergenic
948126949 2:235571175-235571197 TGGGGTGGATCCTTCATGAATGG - Intronic
948842553 2:240661379-240661401 TGGGGTAGATTCTTCATGAATGG - Intergenic
1168906099 20:1405034-1405056 TGAGGTTTAGAAATCATGAATGG - Intergenic
1169635842 20:7690453-7690475 TGGGGTAGATCCTTCATGAATGG + Intergenic
1171954635 20:31451493-31451515 GGAGGTAGATCCTTCATGAATGG + Intergenic
1173773026 20:45680257-45680279 GGGGGTAAATCCTTCATGAATGG + Intergenic
1174457561 20:50660541-50660563 GGAGGTGAATCCCTCATGAATGG - Intronic
1177141220 21:17360206-17360228 GGGGGTGAATCCTTCATGAATGG + Intergenic
1177307531 21:19339130-19339152 TGACGTTAATACATCTTCAATGG - Intergenic
1177674949 21:24284946-24284968 TGAGGTCAAGAGTTCATGACTGG + Intergenic
1177706168 21:24707796-24707818 GTAGGTTAATAAATCATGAAAGG - Intergenic
1177971479 21:27795626-27795648 TGAAGTTAAGTCTGCATGAAAGG + Intergenic
1179020952 21:37640519-37640541 TGAGGCTAATTCTACAAGAAAGG - Intronic
1179484125 21:41698918-41698940 TGGGGTGGATCCTTCATGAATGG - Intergenic
1182051226 22:27314341-27314363 TGAAGTTACAACTTCAAGAAAGG + Intergenic
1182084494 22:27551913-27551935 TGGGGTAGATCCTTCATGAATGG + Intergenic
1182391589 22:30001692-30001714 TGAGTTTAATACATAATAAAGGG + Intronic
1184706964 22:46221242-46221264 TGGGGGTGATCCTTCATGAATGG - Intronic
950687281 3:14627616-14627638 GGAGGTTAGCACTTCATGAAAGG - Intergenic
951101971 3:18699026-18699048 GGGGGTGAATCCTTCATGAATGG - Intergenic
951373736 3:21887187-21887209 TGAAGTGACTATTTCATGAAGGG + Intronic
951463505 3:22976968-22976990 TGAGGTTCAGACCTCATGGAAGG + Intergenic
951503277 3:23414448-23414470 GGAGGTGGATCCTTCATGAACGG - Intronic
951518275 3:23586151-23586173 TTAAGCTAATATTTCATGAAAGG - Intronic
957656808 3:83089905-83089927 TGAGGTGGATCCCTCATGAATGG - Intergenic
957756475 3:84494684-84494706 GGAAGTTTATCCTTCATGAATGG + Intergenic
957893973 3:86395505-86395527 TGATGTAAATAGTTCTTGAAAGG + Intergenic
957915974 3:86687934-86687956 TGAGGTTATTTTTTCATCAATGG - Intergenic
959336427 3:105071181-105071203 AGAGGTGAAAACTACATGAAAGG + Intergenic
959850437 3:111080593-111080615 TGAGCTTTATATTTCAGGAATGG + Intronic
959855166 3:111145341-111145363 TTCGGTTACCACTTCATGAAAGG - Intronic
960040383 3:113144356-113144378 TGATCTTAAAACTTCATGAGAGG - Intergenic
960536002 3:118815252-118815274 GGAGGTGGATCCTTCATGAATGG - Intergenic
960848675 3:122029290-122029312 TGAGGTCAGGAGTTCATGAACGG + Intergenic
961697133 3:128713146-128713168 GGAGGTGGATCCTTCATGAATGG - Intergenic
963678341 3:148342932-148342954 GGGGGTGAATCCTTCATGAATGG + Intergenic
964173287 3:153796285-153796307 AGAGCCTAATACTCCATGAATGG - Intergenic
964354809 3:155840465-155840487 TGAGGTCAGTAGTTCAAGAACGG + Intronic
965712870 3:171573613-171573635 TGAGATTATTAATCCATGAAAGG - Intergenic
965955459 3:174363678-174363700 TATGGTTAAAACTTCATAAATGG + Intergenic
966689409 3:182727579-182727601 GGAGGTTGAAATTTCATGAAGGG + Intergenic
967048130 3:185756086-185756108 GGAGGTGGATCCTTCATGAATGG + Intronic
969139974 4:5060654-5060676 TGAAGAGAATACTTCATCAAAGG - Intronic
970633863 4:17985336-17985358 TGAGGGTATTAGATCATGAAGGG - Intronic
971537318 4:27770077-27770099 TGAGTTTAAAACTTCATATATGG - Intergenic
972463180 4:39325852-39325874 TGATGTTAATAGTTCATGGTGGG - Intronic
972829765 4:42801923-42801945 TGAGGGTGGTCCTTCATGAATGG - Intergenic
973693387 4:53465132-53465154 TGAGCTTAATATTTCCTGCAAGG - Intronic
974400003 4:61391390-61391412 GGAGGTGAATCCCTCATGAATGG - Intronic
975329161 4:73094872-73094894 TGATGTTAAAAATTCATGACTGG + Intronic
975951675 4:79780369-79780391 AGAGGTTAAAACTTAAAGAATGG + Intergenic
977356953 4:95957965-95957987 TGAGGTTGATAGTTCATGAAGGG - Intergenic
978465580 4:109005310-109005332 AGGGGTGAATATTTCATGAATGG - Intronic
979829687 4:125284149-125284171 TCAGGTCAGTACTTCATGAAAGG - Intergenic
980837972 4:138220288-138220310 AATGGGTAATACTTCATGAATGG - Intronic
980994943 4:139771098-139771120 TTGGGTAAAGACTTCATGAATGG - Intronic
981335831 4:143568016-143568038 TGAGGTGGATACCTCAAGAATGG + Intergenic
981780211 4:148420723-148420745 AGGGGTGAATCCTTCATGAATGG + Intronic
982111589 4:152061510-152061532 TGATGCTACTACTTCATGATAGG + Intergenic
982529602 4:156522524-156522546 AGAGGTTAACACTTCATAAATGG + Intergenic
982866476 4:160518923-160518945 GGTGGTGGATACTTCATGAATGG + Intergenic
983084815 4:163429843-163429865 GGAGGTGAATCATTCATGAATGG - Intergenic
983472706 4:168176361-168176383 TGAGGCTAAATCATCATGAAAGG - Intronic
986660291 5:10053307-10053329 GGAGGTGGATCCTTCATGAATGG - Intergenic
988475775 5:31584037-31584059 TGTGGTAATTAATTCATGAAGGG - Intergenic
989142029 5:38210953-38210975 TGAGCTGAAGACTTCACGAAGGG - Intergenic
989551974 5:42746045-42746067 TGAGGGTTCTTCTTCATGAATGG - Intergenic
990404123 5:55470762-55470784 TTAGGTGTAAACTTCATGAAAGG - Intronic
992208299 5:74452411-74452433 GGAGGTGGATCCTTCATGAATGG + Intergenic
995561657 5:113388469-113388491 GGGGGTTAATCCCTCATGAATGG + Intronic
995591756 5:113706884-113706906 TGGGGTGGATTCTTCATGAATGG - Intergenic
997742228 5:136266393-136266415 TGAGCTACAAACTTCATGAAAGG + Exonic
1000720470 5:164699934-164699956 TCAAGTTAAGACTTCATGACTGG + Intergenic
1003754559 6:9102171-9102193 TGAGGTGGATTCCTCATGAATGG - Intergenic
1008695917 6:54036903-54036925 GGAAGTTAATACTTCATAACTGG + Intronic
1009338163 6:62519816-62519838 TACAGTTAATACTTCATAAATGG + Intergenic
1009608753 6:65908688-65908710 TAAGGTTATGATTTCATGAATGG - Intergenic
1010331912 6:74632910-74632932 TGTGTTTAATACTTCCTCAAAGG + Intergenic
1011531925 6:88332332-88332354 GGAGGTGAATCCCTCATGAATGG - Intergenic
1013611204 6:111797426-111797448 TCTGGTTATTTCTTCATGAAAGG - Intronic
1014487359 6:122016080-122016102 TGGGGGAAATCCTTCATGAACGG - Intergenic
1014920194 6:127205371-127205393 TGAAATTAATACTTTATTAATGG - Intergenic
1014937440 6:127400729-127400751 TGAGGTGGATCCTTCCTGAATGG - Intergenic
1015464038 6:133527958-133527980 TGACATTAAAATTTCATGAAAGG - Intronic
1015533259 6:134242088-134242110 TGAGGTTAAAACTGCATGAAGGG + Intronic
1015966740 6:138701826-138701848 AGAGGGTAATACTTGGTGAAAGG - Intergenic
1016773504 6:147878374-147878396 TGATAGTAAAACTTCATGAATGG - Intergenic
1018291063 6:162292968-162292990 TGCAGTAAATACCTCATGAAGGG + Intronic
1020725803 7:11812895-11812917 TGAGTTTATTCTTTCATGAAAGG + Intronic
1020742374 7:12038334-12038356 TGATGTTGATATTTCATGTAAGG - Intergenic
1023634569 7:42196993-42197015 AGAGGATAAAACTTCTTGAAGGG - Intronic
1024771334 7:52726786-52726808 AGAGGCTAAAACTTCTTGAAGGG - Intergenic
1024854675 7:53764330-53764352 TGAGCTTAATACTTCAGTGATGG - Intergenic
1025473716 7:60892835-60892857 TGGGGTTGGAACTTCATGAATGG - Intergenic
1025489050 7:61088845-61088867 TGGGGTTGGAACTTCATGAATGG + Intergenic
1025513289 7:61597031-61597053 TGGGGTTGGAACTTCATGAATGG + Intergenic
1026108636 7:67440619-67440641 GGAGGTGAAGTCTTCATGAATGG + Intergenic
1027518694 7:79175941-79175963 TGAGGTTAATGCCCCATGCAAGG - Intronic
1027587073 7:80071419-80071441 TGAGGTTGATTCTTCATTGATGG - Intergenic
1027829335 7:83157172-83157194 TAAGGATAATATTTGATGAATGG - Intronic
1028174162 7:87634176-87634198 GGGGGTGGATACTTCATGAATGG - Intronic
1029502286 7:100939389-100939411 GGAGGTGAATCCTTCATAAATGG - Intergenic
1030313153 7:108088014-108088036 TGAGGTAAACCATTCATGAATGG - Intronic
1030681465 7:112438856-112438878 TCAGGTCAATGATTCATGAATGG - Intronic
1030938783 7:115618803-115618825 TGAGGATAATAAATCGTGAAGGG - Intergenic
1031523239 7:122792290-122792312 AGAGGTGATTAGTTCATGAATGG + Intronic
1033845010 7:145421188-145421210 TGGGGTGAATCCCTCATGAAGGG + Intergenic
1034184006 7:149160436-149160458 TGGGGTTAAGACTGCATGTAGGG - Intronic
1034708989 7:153173844-153173866 TGGGGTGGATCCTTCATGAATGG + Intergenic
1034912658 7:155009973-155009995 TGAGGGGAATAGTTCTTGAAGGG + Intergenic
1036385483 8:8275794-8275816 CGAGGTAAATACTTCAGAAAAGG + Intergenic
1036606961 8:10315940-10315962 TGTGGTGATTTCTTCATGAAAGG - Intronic
1038203379 8:25438606-25438628 TGATGTTAGTACTTGAGGAATGG - Intronic
1039541154 8:38372067-38372089 TCAGGTTAATACTTTTTGAATGG + Intronic
1042338981 8:67659054-67659076 AGAGTTTTATATTTCATGAATGG - Intronic
1045714091 8:105021296-105021318 TGGGATTAATATTTCATGATCGG + Intronic
1047012435 8:120686494-120686516 TGAGGTTAATACTTCATGAATGG - Intronic
1047864446 8:129006446-129006468 TGTGGTTGATACTTGATGGATGG + Intergenic
1050280649 9:4046638-4046660 TGAAGATAATACTTCAAGTATGG - Intronic
1050453202 9:5805948-5805970 TGAATTTACTACTTCATGATGGG - Intronic
1051667499 9:19479102-19479124 TGAGGTTTTTACTACATAAATGG + Intergenic
1052069365 9:24063234-24063256 TAAGGGAAATACTTCATGACCGG - Intergenic
1055929087 9:81541173-81541195 TGAGGGTTAAACCTCATGAATGG + Intergenic
1056529907 9:87478216-87478238 TGGGATTAATACTTGAGGAAGGG + Intergenic
1057174899 9:92988999-92989021 AGAGGATAATGTTTCATGAAAGG - Intronic
1059722959 9:116979560-116979582 AGTGGTGAATATTTCATGAAGGG - Intronic
1203445159 Un_GL000219v1:47173-47195 GGAGGTTAAAATATCATGAAAGG - Intergenic
1186385564 X:9107153-9107175 TGGGGTGAATCCCTCATGAACGG + Intronic
1186672814 X:11783879-11783901 TGGGGGTCATCCTTCATGAATGG + Intergenic
1187608634 X:20915580-20915602 GAAGGTGAAGACTTCATGAACGG - Intergenic
1188517663 X:31004948-31004970 TGGGATTAATACTTTATAAAAGG - Intergenic
1189114686 X:38330465-38330487 TGAAGTTAGTACTTCATTTAGGG - Intronic
1189843698 X:45110671-45110693 TGAGGTTAATACTTCTGGCAAGG - Intronic
1190537581 X:51445408-51445430 TGAGGCAAATCCCTCATGAATGG - Intergenic
1192388897 X:70703983-70704005 GGAGGTGGATCCTTCATGAATGG + Intronic
1193423679 X:81315666-81315688 TGGGGAGAATACTACATGAAGGG - Intergenic
1193547165 X:82844826-82844848 TGAGGGTGGTCCTTCATGAATGG + Intergenic
1194249497 X:91557058-91557080 TGGGGTTTATATTTCATGGATGG + Intergenic
1196202667 X:112903108-112903130 TGAGGTCTCTGCTTCATGAATGG + Intergenic
1197133970 X:123039206-123039228 TGAGGTTAAGACTTCAGGGGTGG - Intergenic
1198169287 X:134090055-134090077 TGGGGTGAATCCTTCATGAATGG - Intergenic
1200338422 X:155376283-155376305 TGGGGTGGATCCTTCATGAATGG - Intergenic
1200348047 X:155464409-155464431 TGGGGTGGATCCTTCATGAATGG + Intergenic
1200568455 Y:4798273-4798295 TGGGGTTTATATTTCATGGATGG + Intergenic
1200984783 Y:9293364-9293386 TGAGGGTCATCCTCCATGAATGG + Intergenic
1201569805 Y:15401627-15401649 ATAGGTTAATACCTCATGATTGG + Intergenic
1202125657 Y:21566823-21566845 TGAGGGTCATCCTCCATGAATGG - Intergenic
1202153351 Y:21862569-21862591 TGAGGGTCATCCTCCATGAATGG + Intergenic
1202590703 Y:26480336-26480358 TGAGGAAAATACTTCATTATTGG - Intergenic