ID: 1047015698

View in Genome Browser
Species Human (GRCh38)
Location 8:120720849-120720871
Sequence CTGTGGAAGGGTAAGGTAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 14458
Summary {0: 1, 1: 0, 2: 18, 3: 664, 4: 13775}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047015698 Original CRISPR CTGTGGAAGGGTAAGGTAGG TGG (reversed) Intronic
Too many off-targets to display for this crispr