ID: 1047015998

View in Genome Browser
Species Human (GRCh38)
Location 8:120724171-120724193
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047015994_1047015998 7 Left 1047015994 8:120724141-120724163 CCTTTTTGCTGTAGGTTCAAACT 0: 1
1: 0
2: 0
3: 7
4: 154
Right 1047015998 8:120724171-120724193 CTGCAAAGGAGCCCTGTTTCAGG No data
1047015993_1047015998 11 Left 1047015993 8:120724137-120724159 CCAGCCTTTTTGCTGTAGGTTCA 0: 1
1: 0
2: 2
3: 9
4: 168
Right 1047015998 8:120724171-120724193 CTGCAAAGGAGCCCTGTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr