ID: 1047019409

View in Genome Browser
Species Human (GRCh38)
Location 8:120758907-120758929
Sequence TAAGTGGGTTGCTGCCAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 103}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047019409_1047019413 9 Left 1047019409 8:120758907-120758929 CCTCCTTGGCAGCAACCCACTTA 0: 1
1: 0
2: 1
3: 6
4: 103
Right 1047019413 8:120758939-120758961 TTATTATTATTTTATAGAGACGG 0: 8
1: 75
2: 847
3: 4689
4: 18421
1047019409_1047019414 30 Left 1047019409 8:120758907-120758929 CCTCCTTGGCAGCAACCCACTTA 0: 1
1: 0
2: 1
3: 6
4: 103
Right 1047019414 8:120758960-120758982 GGTGTCTTGCCATGTTGCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047019409 Original CRISPR TAAGTGGGTTGCTGCCAAGG AGG (reversed) Intronic
900790574 1:4677253-4677275 TGGCTGGGATGCTGCCAAGGGGG + Intronic
901906296 1:12414640-12414662 TGAGTGGGCTGCTTCCAAGATGG + Intronic
907010806 1:50960883-50960905 TAATAGGGTTGCTCCAAAGGGGG + Intronic
908669803 1:66533791-66533813 TAAGTGGCTCGCTGCGGAGGGGG - Intronic
909329410 1:74394526-74394548 AAAGGGGGTTGCTGACAAGCAGG - Intronic
912703852 1:111897569-111897591 TATGTGGGTTTCTGCCTATGTGG + Intronic
913607339 1:120478155-120478177 AAAGAGGGTTGCTTCCAAGATGG + Intergenic
914209094 1:145561984-145562006 AAAGAGGGTTGCTTCCAAGATGG - Intergenic
914268013 1:146054350-146054372 AAAGAGGGTTGCTTCCAAGATGG - Intergenic
914369083 1:147006509-147006531 AAAGAGGGTTGCTTCCAAGATGG + Intergenic
914583854 1:149043679-149043701 AAAGAGGGTTGCTTCCAAGATGG - Intronic
918841933 1:189552307-189552329 TTAGGGGTTTGCTGCCAAGGGGG - Intergenic
920074656 1:203327450-203327472 TCAGCGGCTTGTTGCCAAGGTGG - Intergenic
922795859 1:228339114-228339136 CAGGTGGGTTGGAGCCAAGGGGG + Intronic
1072686243 10:97539067-97539089 TGAGTTGGGTGCTGCCCAGGAGG + Intronic
1075516145 10:123109777-123109799 CAAGTAGGTGGCTCCCAAGGAGG - Intergenic
1077450527 11:2640338-2640360 TAAGTGGGGTGGTTCCAAGATGG - Intronic
1078168345 11:8910284-8910306 AAACTGTGTGGCTGCCAAGGTGG - Intronic
1079779517 11:24583296-24583318 TAAGTCGGTTGCTGGCAAACTGG - Intronic
1084290312 11:68161070-68161092 CATGTGGGCTGCTACCAAGGTGG + Intronic
1085324441 11:75595734-75595756 TGATAGGGCTGCTGCCAAGGTGG - Intronic
1088078552 11:105881242-105881264 TATGTGGGCTGCTGGGAAGGAGG + Intronic
1091611269 12:2011842-2011864 TAGGTGGCTTCCTGCCAGGGTGG + Intronic
1096799158 12:54097987-54098009 TCTGTGTGTGGCTGCCAAGGTGG + Intergenic
1098834495 12:75405652-75405674 AAAGTGGGTTGCTGGCAAACTGG - Intronic
1098953188 12:76662886-76662908 TAAGTGGGTTGGGGCCAGTGAGG + Intergenic
1100061849 12:90588949-90588971 TCAGTGGGTGGCTGCAAATGTGG - Intergenic
1101412934 12:104484188-104484210 TCAGTGGGTCATTGCCAAGGAGG + Intronic
1102216957 12:111168463-111168485 TAAGTTGGTTCCTTCCAAGCAGG + Intronic
1103733727 12:123045244-123045266 GAAGCGGGATGGTGCCAAGGAGG - Intronic
1107473560 13:40713300-40713322 GAAGGGGGTGGCTGGCAAGGTGG - Intergenic
1109452764 13:62539829-62539851 TATGCAGGCTGCTGCCAAGGAGG - Intergenic
1111709683 13:91795760-91795782 GGAATGGGTTGCAGCCAAGGAGG - Intronic
1112336413 13:98520805-98520827 TATGTGCGTTGTTGCCATGGTGG - Intronic
1115782338 14:36783522-36783544 TATGTGGGATGCTGCCAAGGAGG - Intronic
1122621187 14:103058217-103058239 TCTGGGGGATGCTGCCAAGGCGG + Intergenic
1124157029 15:27234917-27234939 AAAGGGGGTTGCTGTCAGGGTGG + Intronic
1124985171 15:34602047-34602069 GGAATGGGTTGCAGCCAAGGAGG - Intergenic
1126734053 15:51713942-51713964 TAGGTGTGTTACTGCCAAGGAGG + Intronic
1127052673 15:55101118-55101140 TAAATGGGATGATGGCAAGGAGG - Intergenic
1127253945 15:57271713-57271735 GAGGTGGGTTGCTTCCAAGATGG - Intronic
1129395230 15:75240784-75240806 TGAGTTGAGTGCTGCCAAGGTGG - Intergenic
1132571477 16:646259-646281 GGAGTGGGTTGCAGGCAAGGGGG + Intronic
1133647852 16:7781100-7781122 TAAATGAGATGCTGCCTAGGAGG - Intergenic
1133804776 16:9116602-9116624 TAAGTGGGTTGCTTTCAAAAGGG + Intronic
1142907119 17:3051256-3051278 TAAGTGGGTTGCTTGCCTGGTGG + Intergenic
1142927449 17:3253000-3253022 TAAGTGGGTTGCTTGCCTGGTGG - Intergenic
1143099140 17:4495663-4495685 TAGGTGAGAGGCTGCCAAGGGGG + Intergenic
1143318912 17:6054997-6055019 TGAGTGGGTTGCTGCCTCGGAGG + Intronic
1147363066 17:39943547-39943569 TACCTGGGTGGCTGCCAAGTGGG - Intronic
1148685822 17:49500700-49500722 TGAGTGTGTTGCTGCCCTGGAGG + Intronic
1150452891 17:65283946-65283968 CCAGTGGGTTGCTGGCAAAGCGG - Intergenic
1159974149 18:74689889-74689911 CAGGTGGGATGCTGCCATGGTGG + Intronic
1161777094 19:6269587-6269609 TAAGTGGTTTGCAGCCTAGTGGG - Intronic
1161881047 19:6952882-6952904 TTAGTGAGTTTCTGGCAAGGTGG + Intergenic
1162191003 19:8946815-8946837 TGAGTGGGTCCTTGCCAAGGGGG + Exonic
1162757143 19:12867206-12867228 TAAGGGGGTTGCTGGGAAGATGG + Intronic
1168549910 19:57284169-57284191 CAAGTGGCTTCCTGCCTAGGAGG + Intronic
1168634958 19:57989010-57989032 GAAGAGGGGTGTTGCCAAGGTGG - Intronic
930053836 2:47237130-47237152 TAGGTCGGGTGCTGGCAAGGTGG + Intergenic
932957574 2:76372311-76372333 AAAGTGGGTTGCCGGCAATGAGG + Intergenic
938188850 2:129256235-129256257 TAAGTAGGTGGGTGCCTAGGTGG - Intergenic
939478309 2:142715304-142715326 TCAGTGGGCTGGTGTCAAGGTGG + Intergenic
943482163 2:188433217-188433239 TGACTGGGTTGCTCCAAAGGGGG + Intronic
944000379 2:194828144-194828166 TAAGATGGTTGCTTCCAAGTAGG - Intergenic
947418339 2:229921247-229921269 TAAGGGGTTTCCTGCCCAGGGGG - Intronic
948936510 2:241168647-241168669 TACGTGGCATGCTGCCTAGGAGG - Intronic
1169722255 20:8691536-8691558 TAAGTTGGGTGGTGACAAGGAGG - Intronic
1170613573 20:17932662-17932684 TTAGTGGGTTGCAGGAAAGGAGG - Intergenic
1170953062 20:20954074-20954096 AAATTGGGGTCCTGCCAAGGAGG + Intergenic
1171207927 20:23295604-23295626 TAACTGGGTGGCTGGCAAGCTGG - Intergenic
1171797268 20:29576361-29576383 TCTGTGTGTGGCTGCCAAGGTGG - Intergenic
1171940565 20:31324876-31324898 TTTGTGGCTTTCTGCCAAGGTGG - Intergenic
1178949686 21:36975821-36975843 TAAGTGAATGGCTGCCAATGAGG - Intronic
1184467454 22:44677193-44677215 GAGGTGGGATGCTGCCAGGGTGG - Exonic
949423620 3:3892054-3892076 GAAGTGGGTAGCTGACAAGGTGG - Intronic
950368811 3:12509657-12509679 TTACTGGGGTGCTGCCATGGTGG - Intronic
950480305 3:13239623-13239645 TAAGTGGGGTGCTGCTTGGGGGG - Intergenic
952890743 3:38038775-38038797 TTAGTGGGTTAAGGCCAAGGTGG - Intergenic
958571281 3:95885484-95885506 TAAGTGGGCTGCTCCCAATTTGG - Intergenic
959025545 3:101236394-101236416 TAAGGTGGTGGCTGCCAAGATGG + Intronic
964469796 3:157040659-157040681 TGAGTGGGTGGCTGTCCAGGTGG - Intronic
966726622 3:183114680-183114702 TAAGTGGCTTGCTCTCTAGGAGG - Intronic
968765925 4:2469110-2469132 GAAGTGGGTTGCTGTTGAGGCGG + Intronic
973629001 4:52801645-52801667 TCTGTGGGTTGCTGGCAAGATGG + Intergenic
976480475 4:85538049-85538071 TAAGTGGCTTTCTCCCAAAGTGG - Intronic
983080611 4:163380850-163380872 TGAATGGGTTGGTGCCATGGCGG + Intergenic
986250157 5:6048282-6048304 TTAGTTGGTTGCTTACAAGGTGG - Intergenic
988682864 5:33501210-33501232 TTAGTGGGATGCTGCCACGTGGG + Intergenic
989538865 5:42595760-42595782 GAAGTGGGTTGCTGGAGAGGCGG + Intronic
998785017 5:145699744-145699766 TAAGTGGGTTGCTGGAGAGCTGG - Intronic
998934082 5:147216000-147216022 AAACTGGATTGCTGGCAAGGTGG + Intergenic
1003566638 6:7228231-7228253 GAAGGGGGATGCTGCCTAGGAGG - Intronic
1004192230 6:13473857-13473879 TTGGTGGGTTGCTGAGAAGGTGG - Intronic
1012600556 6:101091950-101091972 TAGGTGGGTTCCTGCTATGGTGG + Intergenic
1014021623 6:116597125-116597147 GCAGTGGGTTGCTGCAAAGGAGG + Exonic
1015094162 6:129395030-129395052 TAATTTGGTTGCTGCCAAAATGG + Intronic
1015623503 6:135156779-135156801 AAAGAGGGTAGCTGGCAAGGTGG - Intergenic
1018483621 6:164216941-164216963 TAAGTGGGTTGCTGAGACTGGGG - Intergenic
1021486649 7:21175446-21175468 GAGGTAGGTTGCTCCCAAGGAGG - Intergenic
1022562383 7:31363317-31363339 TAAGTGTTTTGCTGCAAAGTGGG - Intergenic
1026602351 7:71787199-71787221 TAAGTGGGGTGCAGCCCTGGCGG - Exonic
1033188946 7:139258393-139258415 TAAGGGAGATGCTGCCATGGTGG + Intronic
1038342082 8:26694885-26694907 GAACTGGGTTGCTGGGAAGGGGG + Intergenic
1047019409 8:120758907-120758929 TAAGTGGGTTGCTGCCAAGGAGG - Intronic
1050615592 9:7398659-7398681 TCAGTGGGATGCTGCCACGGGGG - Intergenic
1055028526 9:71748314-71748336 CAAGTGGGTAGCTGGGAAGGTGG - Intronic
1057189273 9:93077391-93077413 TCAGTGGGTAGGAGCCAAGGAGG + Intronic
1060008158 9:120018716-120018738 TGACTGGGATGCTGCCCAGGTGG + Intergenic
1060833039 9:126731186-126731208 TGTGTGGGTTTCTGCCAAAGTGG - Intergenic
1199819422 X:151430141-151430163 TCAGTTGATTTCTGCCAAGGTGG + Intergenic