ID: 1047021185

View in Genome Browser
Species Human (GRCh38)
Location 8:120776448-120776470
Sequence GGAGTCTGTAGAAATGGCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 152}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047021185_1047021189 -1 Left 1047021185 8:120776448-120776470 CCTGAGCCATTTCTACAGACTCC 0: 1
1: 0
2: 3
3: 20
4: 152
Right 1047021189 8:120776470-120776492 CAAGAGGTTCTAACCAGCCCAGG No data
1047021185_1047021193 24 Left 1047021185 8:120776448-120776470 CCTGAGCCATTTCTACAGACTCC 0: 1
1: 0
2: 3
3: 20
4: 152
Right 1047021193 8:120776495-120776517 ACTTCCACTTTTGAGACCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047021185 Original CRISPR GGAGTCTGTAGAAATGGCTC AGG (reversed) Intronic
902776762 1:18679709-18679731 GGGGTCTGTAGGCATGGCTTGGG + Intronic
906475124 1:46164410-46164432 GGAGGCTGTGGTAATGCCTCAGG - Intronic
906493799 1:46288694-46288716 GGAGTCTGGGGAAATAGCTAAGG - Intronic
909128214 1:71702446-71702468 GGAGTAGGTAGAAGTGACTCTGG + Intronic
911248474 1:95547480-95547502 GGAGACTCTTGAGATGGCTCTGG - Intergenic
911249689 1:95560728-95560750 GAATTCTGTAGAATTTGCTCAGG - Intergenic
915214265 1:154329372-154329394 GGGGTGTGTAGAAAGGGTTCTGG + Intronic
915699299 1:157775691-157775713 GGATTCTATAGAGGTGGCTCTGG - Intronic
917190212 1:172408909-172408931 GAAGTCAGTAGAAATGGCATGGG + Exonic
918753207 1:188300126-188300148 GGAGTGTGTAGTAATGGAGCAGG + Intergenic
920932478 1:210401529-210401551 TGAGTCTGTCAAAATGCCTCTGG - Intronic
923908828 1:238416585-238416607 TGTGTCTGTATATATGGCTCAGG + Intergenic
1063976857 10:11424268-11424290 GCCGTCTGTAGACATGGCTGGGG - Intergenic
1070683092 10:78462761-78462783 GGAGGCTGTTGCAGTGGCTCTGG - Intergenic
1074307882 10:112296019-112296041 GAAGAATGTAGAAATGGGTCGGG - Intronic
1075060951 10:119256341-119256363 GGAGTCTGGAGTCCTGGCTCCGG + Intronic
1075104782 10:119531768-119531790 GGATTCTGCAGACATGGCCCTGG - Intronic
1077309925 11:1883754-1883776 GGAGTCTGGAGAGATGTCTCCGG - Intronic
1079064414 11:17276887-17276909 GGAGTCCGGAGATAAGGCTCCGG + Intronic
1080236489 11:30074736-30074758 GGAGTCAGTAGAATTGGGTTTGG - Intergenic
1081302626 11:41471293-41471315 GGAGTCTTTAGAATTAGCTGAGG - Intergenic
1082962646 11:58934182-58934204 GGAATCTGGAGAAATGGGCCTGG + Intronic
1083517962 11:63278399-63278421 GGAGTCTGAAGAAATATCACAGG + Intronic
1085198925 11:74689719-74689741 GGACTTTGTACAAGTGGCTCAGG + Intergenic
1087168947 11:95031057-95031079 GGAGCCTGGAGTATTGGCTCCGG - Intergenic
1087276259 11:96163281-96163303 GGATGCTGTAGAAATGATTCAGG + Intronic
1089376616 11:117999401-117999423 GGATCCTCTAGAAATGACTCTGG + Exonic
1090112007 11:123922214-123922236 GGGGTCTGTACAGATGGCTCTGG + Intergenic
1091388349 12:109505-109527 GGAGGGTGTAGAAAGGGTTCAGG - Intronic
1094301319 12:28967745-28967767 GGAGTCTGCAGAATTTGCTGAGG - Intergenic
1098054839 12:66493963-66493985 GGAATCTGTAAAGATGCCTCTGG + Intronic
1098130973 12:67349266-67349288 GAAGGCTGTAGCAATGGTTCTGG + Intergenic
1098271788 12:68776725-68776747 GGAGTCTGGAAAAATGGCGGGGG - Exonic
1098874519 12:75853261-75853283 GGAATCTATAGAAATAGCCCAGG - Intergenic
1098875806 12:75865397-75865419 GGAGTCTGCATAAAAGGCTCAGG - Intergenic
1100002590 12:89855370-89855392 GGAGGCAGAGGAAATGGCTCAGG - Intergenic
1100887561 12:99088281-99088303 GGAGTCTGCAGAACTGGGTTTGG + Intronic
1101474685 12:105033535-105033557 GGGGTGTGGAGAATTGGCTCTGG + Intronic
1102143444 12:110636072-110636094 GGAGTCTGTGGAAATCGCCTGGG + Intronic
1102644773 12:114396747-114396769 GGAACCTTTAGAAATGGCTCCGG + Intronic
1107000906 13:35544058-35544080 GGAATTTGTGGCAATGGCTCAGG - Intronic
1107112765 13:36715936-36715958 GGAGAATTGAGAAATGGCTCAGG + Intergenic
1109379753 13:61543898-61543920 GGAGCCTGGACAAAAGGCTCTGG - Intergenic
1110616261 13:77545652-77545674 GAAGCTTCTAGAAATGGCTCTGG + Intronic
1111037339 13:82693930-82693952 GGAGTTGGTAGAAATGGCAGTGG + Intergenic
1112213246 13:97402574-97402596 GAAGTCTCTTGAAATGGATCTGG + Intergenic
1114929616 14:27450958-27450980 TGAATCTGCAGAAATGGGTCTGG + Intergenic
1115855445 14:37625206-37625228 GGAATTTGTTGAAATGGCACTGG + Intronic
1117062208 14:51974567-51974589 CGAGTCTGGAGAAAAGTCTCAGG + Intronic
1117728099 14:58694051-58694073 GGAGGCTGAAGAAATAGGTCCGG + Intergenic
1117853312 14:59999496-59999518 GTAGGCTCTAGAAAGGGCTCTGG - Intronic
1122299622 14:100724485-100724507 GGAGTCTGTCAAAATGTCACAGG - Intergenic
1127329394 15:57923763-57923785 GAAGTGTGTAGAAAAGACTCAGG + Intergenic
1130601057 15:85273658-85273680 GGAGTCAGTAGAAAGAACTCAGG + Intergenic
1130811709 15:87385832-87385854 GAAGTCTGGAGAAAAGGTTCAGG + Intergenic
1132146707 15:99433577-99433599 GGAAGCTGCAGAAATAGCTCTGG - Intergenic
1132851056 16:2025260-2025282 GGAGTCTGTGAAGATGGCTGTGG - Intergenic
1134889486 16:17826750-17826772 GGATTCTGAAGAAACGGCTTTGG - Intergenic
1136103989 16:28015797-28015819 GGAGTCTACAGAAGTGCCTCTGG + Intronic
1136747314 16:32602238-32602260 GGAGTCTGTAGAACTTCCTCAGG + Intergenic
1139123912 16:64054567-64054589 CTATTCTGTAGAATTGGCTCAGG - Intergenic
1139663637 16:68439824-68439846 GGAGTCAGGAGAAATGGCTCTGG + Intronic
1203049449 16_KI270728v1_random:861444-861466 GGAGTCTGTAGAACTTCCTCAGG + Intergenic
1143969625 17:10786074-10786096 GGAGTGTGTGGAGGTGGCTCTGG + Intergenic
1144772933 17:17769851-17769873 GGAGACTGAAGAGATGGGTCGGG + Intronic
1145037740 17:19553032-19553054 GGGTTCTGTAGAAATGGCAGGGG + Intronic
1146276744 17:31521195-31521217 GGAGTGTGTAGAAAGGTCTGAGG - Exonic
1148565480 17:48630625-48630647 TGAGTCTGAAGAAATACCTCTGG - Intronic
1149544861 17:57495953-57495975 GGAGTCTTTTGCTATGGCTCAGG + Intronic
1151540669 17:74763211-74763233 GGACTCTGCAGAAATGGCGGGGG + Intronic
1152023741 17:77795597-77795619 AGAGTTTCCAGAAATGGCTCCGG + Intergenic
1154948218 18:21183318-21183340 TGAATCTGCAGAAAAGGCTCTGG - Intergenic
1156796344 18:41050892-41050914 GGGGTCTGAAGAAATGCCCCAGG + Intergenic
1160024338 18:75205914-75205936 AGAGTTTGTAGGAATGGCTAAGG - Intronic
1163901241 19:20101965-20101987 GGAGAATGTAGAGAAGGCTCTGG - Intronic
1167693415 19:51001016-51001038 GGAGTCTGTGGGAATGCCGCGGG - Intronic
926934001 2:18068308-18068330 GCAGTGTGTGGAAATGGATCGGG + Intronic
927641847 2:24850353-24850375 GGAGTCTTTAGCCAGGGCTCTGG - Intronic
929620052 2:43345576-43345598 GGAGTCTGGAGCAATGGGTCTGG + Intronic
930062791 2:47304750-47304772 GGAGTCTGAAAAAGTGGCCCAGG - Intergenic
930562548 2:52978680-52978702 ATAGTCTATAGAAATGGCTCAGG + Intergenic
931430233 2:62203370-62203392 GGAGTCTGTAGTGATGTCTAGGG + Intronic
932020353 2:68078671-68078693 GGAGTATTCAGAAATGGCTCTGG - Intronic
934091634 2:88555639-88555661 GGACTCAGTAGAAAGGGCTGTGG + Intergenic
934120070 2:88829674-88829696 TGAGTCTATAGAAATGGTTCAGG + Intergenic
935367932 2:102314369-102314391 TGAGTCTGTGGGATTGGCTCTGG + Intronic
937170632 2:119863457-119863479 GGAGGCTGAAGAAATGGTTCTGG + Intronic
942462139 2:176175652-176175674 GGGGTCTGAAGAAAGGGGTCAGG + Intergenic
942689268 2:178568114-178568136 GGAGTCTTTGGAAATGGCTGTGG + Exonic
942940205 2:181606696-181606718 GGTGACTGTAGAAATGGACCAGG - Intronic
947230322 2:227877959-227877981 GGATGCTGTACAAATGGATCTGG - Intronic
947705264 2:232269795-232269817 GGAGTCTGTAGGAATGAACCAGG + Intronic
1169001037 20:2168234-2168256 GGTGTCTGCAGAAGTGTCTCAGG - Intronic
1170290708 20:14765286-14765308 GGAGTTGGCAGAAATGGGTCTGG + Intronic
1171437442 20:25134312-25134334 GGTCTCTGTAACAATGGCTCAGG + Intergenic
1173126577 20:40342085-40342107 GGAGCCTGGAGCAATGGGTCTGG - Intergenic
1174773561 20:53323375-53323397 GAAGTCTGTAGAAAGTGCCCTGG + Intronic
1175364790 20:58445331-58445353 GGAGTCAGGACAAATGGATCGGG + Exonic
1175906543 20:62382678-62382700 GGATTCTGCAAAAAAGGCTCAGG + Intergenic
1176993751 21:15529407-15529429 GTAGCCAGTAGAAGTGGCTCAGG + Intergenic
1178207905 21:30491785-30491807 GGAGGCTATGGATATGGCTCTGG - Exonic
1178211682 21:30541730-30541752 GGAGGCTACAGATATGGCTCTGG - Exonic
1178228033 21:30747150-30747172 GGGGGCTGTGGATATGGCTCTGG - Exonic
1182719233 22:32384262-32384284 GGAGTCTGGAGAAACAGCTAAGG - Intergenic
1184309084 22:43629564-43629586 GAATGATGTAGAAATGGCTCGGG + Intronic
950399482 3:12759465-12759487 GGAGTCTGAAGGCATGGCTGTGG - Exonic
950549400 3:13657024-13657046 GGGGTCTATAGAAATGAATCAGG - Intergenic
954427735 3:50452208-50452230 GCTGTCTGTGGAATTGGCTCAGG + Intronic
955418162 3:58712012-58712034 GCGGTCTGGACAAATGGCTCTGG + Intergenic
959516543 3:107273396-107273418 GGACTGAGTAGAAATGGCTTTGG - Intergenic
961439615 3:126945096-126945118 GGAGTTTGTGGAAAAGGCTGGGG + Intronic
963524368 3:146397738-146397760 GGTGTCAGTAAAAATGGCTTTGG + Intronic
964389430 3:156182460-156182482 TGAGTTGGTAGAAATGGCTGAGG - Intronic
964833275 3:160909891-160909913 AGAGTTTGTAGAAGTAGCTCTGG + Intronic
964880256 3:161416017-161416039 AGAGGCTGTAGAAAAGCCTCGGG - Intergenic
965448347 3:168804562-168804584 GGAGTCTCTTGAAGTTGCTCAGG - Intergenic
967905989 3:194500731-194500753 GTAGTTAGTAGAAATGGCTTTGG - Intergenic
968909001 4:3467141-3467163 GGAGTCCGCAGAAGTGGCTGCGG - Intronic
974459817 4:62172920-62172942 GGGGTTTGTAGAAATGGTTCAGG - Intergenic
976799359 4:88971461-88971483 GGACTTTTTAAAAATGGCTCTGG + Intronic
985725423 5:1513595-1513617 AGAGCCTGTGGAAATGGGTCAGG - Intronic
986002831 5:3643474-3643496 GGGGTCAGTAGGAATGACTCTGG - Intergenic
989350445 5:40479866-40479888 TGATTCTGTAGAAATGAGTCTGG - Intergenic
993419560 5:87683949-87683971 GGAGTCTAGAGACATGGCTGGGG - Intergenic
995644557 5:114296505-114296527 GGTCTCTGTAGAAATGGCCTTGG + Intergenic
998600429 5:143579709-143579731 GGAGACTGAAGACATGGCTAAGG - Intergenic
1001334985 5:170789594-170789616 GGAGTCAGCTGAAAGGGCTCAGG - Intronic
1001439414 5:171728501-171728523 GTATTTTGTAGAAATTGCTCTGG - Intergenic
1002441526 5:179266903-179266925 GGAGGCTGGAGCAATGGCACAGG - Intronic
1004149191 6:13098856-13098878 GGAGGCTGTTGTGATGGCTCAGG - Intronic
1005138493 6:22599328-22599350 GGATGCAGTAGAAATAGCTCAGG + Intergenic
1007678917 6:43621089-43621111 AGAGTCTGAAGAAATGGCACAGG - Exonic
1007787152 6:44287247-44287269 GGAGGAAGTAGATATGGCTCAGG + Intronic
1011703351 6:89976202-89976224 TGAGTCTGGAGAACTGGCTTGGG + Intronic
1012006057 6:93715202-93715224 GGAGTCTATGGAAATGGCTATGG + Intergenic
1013369765 6:109458669-109458691 GGATCCTGTCGTAATGGCTCAGG - Intergenic
1016311658 6:142739845-142739867 GGAGTTGGAAGAAATGGCACTGG - Intergenic
1017893170 6:158656026-158656048 GGAGTCAGGAGAACTGGATCGGG + Intronic
1018329525 6:162712255-162712277 GCAGTCTTGAGAAATGGCCCAGG - Intronic
1019487698 7:1296819-1296841 GGAGTCTGGAGAAATGCCACCGG - Intergenic
1020681133 7:11238033-11238055 GGAGGCTGCAGTCATGGCTCTGG - Intergenic
1022857780 7:34332566-34332588 GGAGTAGGTAGGAATGGCTCGGG - Intergenic
1023154620 7:37236183-37236205 GGAGTCTGTAGACAGAGCTCTGG - Intronic
1023294490 7:38700791-38700813 GAAGTCTTTGGAACTGGCTCTGG - Intergenic
1023826309 7:44012246-44012268 TGAGTCTGTAGAAATGGTCAAGG - Intergenic
1024985320 7:55188933-55188955 ACACTGTGTAGAAATGGCTCAGG + Intronic
1026902373 7:74044347-74044369 GGAGTTTGGGGAAATGGCTCAGG - Intronic
1028639475 7:93027061-93027083 TGAGTCTCTAGAAAGGGATCTGG + Intergenic
1029513425 7:101011014-101011036 GGAGTAGGAAGAGATGGCTCAGG + Intronic
1029718018 7:102343602-102343624 TGAGTCTGTAGAAATGGTCAAGG + Intergenic
1029754596 7:102565643-102565665 TGAGTCTGTAGAAATGGTCAAGG - Intronic
1029772547 7:102664727-102664749 TGAGTCTGTAGAAATGGTCAAGG - Intronic
1032854146 7:135820293-135820315 GGACTCTGTAAAACTTGCTCGGG - Intergenic
1038187778 8:25291281-25291303 GGAGGGTGTAGAAATGGCTCGGG + Intronic
1038446273 8:27606370-27606392 CGCGTCTGCAGAAGTGGCTCAGG - Exonic
1040492483 8:47937509-47937531 TGAGTCTGAAAAAATGGCTCTGG - Intronic
1045897459 8:107236744-107236766 GGATTATCTAGAAGTGGCTCAGG + Intergenic
1045976562 8:108136381-108136403 GGAGTGTATTAAAATGGCTCAGG - Intergenic
1047021185 8:120776448-120776470 GGAGTCTGTAGAAATGGCTCAGG - Intronic
1047517863 8:125570528-125570550 GGAGTCTGTTGAAATGACTCAGG - Intergenic
1049276177 8:141721157-141721179 GGAGCCTGTGGCCATGGCTCAGG + Intergenic
1049344844 8:142133378-142133400 GGAGTTTGCAGAAATGTCTGCGG + Intergenic
1049444554 8:142624060-142624082 GGTGTCTGAAGGAAGGGCTCTGG + Intergenic
1049654353 8:143791276-143791298 GGAGGATGGAGAAGTGGCTCTGG - Exonic
1055460900 9:76519381-76519403 GCAGTTTCTAGAAATGGCTTGGG - Intergenic
1059566800 9:115390667-115390689 GGAGTCTGGAGACCTGGGTCTGG + Intronic
1061842280 9:133366070-133366092 GAAGTCTGTGGAAATGCCTTTGG - Intronic
1062208893 9:135352539-135352561 GGATTGGGTAGAAATGACTCAGG - Intergenic
1062343353 9:136103596-136103618 GGTGCCTGTGGAACTGGCTCAGG + Intergenic
1189031391 X:37455070-37455092 GGAGTCTGTAGGGATGGAGCTGG - Exonic
1192634401 X:72804166-72804188 GCAGTCTGTAGAATTACCTCAGG + Intronic
1192647309 X:72916635-72916657 GCAGTCTGTAGAATTACCTCAGG - Intronic
1195327919 X:103773115-103773137 GCATTCTCTAGAGATGGCTCTGG + Intergenic
1195980658 X:110574683-110574705 GGATTCTGAAAAAATGGCCCAGG + Intergenic
1199525084 X:148783252-148783274 AGAGTCTGAGAAAATGGCTCAGG - Intronic
1201893378 Y:18967580-18967602 GCAGTCTATGGAAATGGCACTGG - Intergenic