ID: 1047021563

View in Genome Browser
Species Human (GRCh38)
Location 8:120780236-120780258
Sequence GAGGCAAGCCAATTTGGTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 111}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047021563 Original CRISPR GAGGCAAGCCAATTTGGTGG TGG (reversed) Intronic
904276870 1:29390634-29390656 GAGGCCAGCCAGGTTGGAGGAGG - Intergenic
908797320 1:67843648-67843670 GAGGCAAGAGAAGTTGGGGGAGG - Intergenic
910838670 1:91540703-91540725 TAGATAAGCCAACTTGGTGGGGG - Intergenic
911051505 1:93675552-93675574 GAGGAAAGCCACTGGGGTGGGGG + Intronic
913973805 1:143437657-143437679 GAGGAAAGCAAACCTGGTGGTGG - Intergenic
914068190 1:144263264-144263286 GAGGAAAGCAAACCTGGTGGTGG - Intergenic
914110965 1:144703090-144703112 GAGGAAAGCAAACCTGGTGGTGG + Intergenic
914316056 1:146512917-146512939 GGGGAAAGATAATTTGGTGGGGG + Intergenic
914498299 1:148220444-148220466 GGGGAAAGATAATTTGGTGGGGG - Intergenic
914505114 1:148281968-148281990 GAGGAAAGGCAATCTGGTGCCGG + Intergenic
914745506 1:150498420-150498442 TAGGCAAGCAGATTGGGTGGAGG + Intronic
915047047 1:153026695-153026717 GAGGAGAGACAATGTGGTGGTGG - Intergenic
919526772 1:198663269-198663291 GAGCCAAACCAAGCTGGTGGTGG + Intronic
920374760 1:205502009-205502031 GAAGCAATCCCATGTGGTGGTGG + Intergenic
924306678 1:242696832-242696854 GAGGGAATACAAGTTGGTGGAGG + Intergenic
924899505 1:248382082-248382104 GTGGCCACACAATTTGGTGGTGG + Intergenic
1065935573 10:30517804-30517826 GAGGGAAGCAATTTTGGAGGTGG - Intergenic
1067531041 10:47073319-47073341 GGGGAAAGCCAATCTGGAGGTGG + Intergenic
1070102395 10:73400651-73400673 GAGGAAAGGCAATTGTGTGGGGG - Intronic
1074209528 10:111317131-111317153 AAGGAAAGCAAATTTGCTGGAGG - Intergenic
1081253674 11:40866626-40866648 GAGTCAAGCCAATTGGGTATTGG + Intronic
1083184791 11:61011256-61011278 GAGGCAAGTCCATTGGCTGGAGG - Intronic
1084183450 11:67457873-67457895 GAGGCAAACCACCTTGGTGTGGG + Intronic
1085439250 11:76543420-76543442 GAGGGAAGCCAACTGGCTGGAGG + Intronic
1090561763 11:127940091-127940113 GAGACGACCCAGTTTGGTGGAGG + Intergenic
1096033591 12:48443390-48443412 GAGGCGAGCAGATTTGGTGTTGG + Intergenic
1098593162 12:72238545-72238567 GGGGCCTGCCAGTTTGGTGGGGG - Intronic
1098705435 12:73683526-73683548 GAGGCAATCCAATTGGGATGAGG + Intergenic
1100016909 12:90022991-90023013 GAGCAAAGCCAAGTAGGTGGAGG + Intergenic
1102713424 12:114948946-114948968 GAAACAAGCCACCTTGGTGGGGG - Intergenic
1107784019 13:43936246-43936268 TAGGCATTCCAATTTGTTGGTGG - Intergenic
1108165956 13:47693326-47693348 GATGCAGGCAGATTTGGTGGTGG - Intergenic
1110238457 13:73241071-73241093 AAGGCAAGCAAATTTGGTGGGGG + Intergenic
1116303335 14:43215770-43215792 AAGGAGAGCCAATTTGATGGGGG - Intergenic
1116481747 14:45399430-45399452 GAGGCAAGCCAATGGAGTGGCGG + Intergenic
1117513213 14:56473421-56473443 GAGGAAAACCAATTTGGGGGAGG - Intergenic
1118687306 14:68303599-68303621 GAGGCAAGTCACTTTGGGGTGGG + Intronic
1124241630 15:28033048-28033070 CAGGCAGGCCAGTGTGGTGGAGG - Intronic
1132525024 16:410179-410201 GAGGGATGCCAAGTGGGTGGTGG - Intronic
1134192933 16:12136450-12136472 GACCCAAGCTAATTTGGTGTGGG - Intronic
1140414447 16:74763905-74763927 CAGGCAAGCAAATTTGAAGGTGG - Intronic
1141122842 16:81374849-81374871 GTGCCAAGGCAATTTAGTGGGGG + Intronic
1142701657 17:1665927-1665949 GAGGCAAGCTGATCAGGTGGTGG + Intronic
1143875557 17:9988152-9988174 GAAGAAAGAAAATTTGGTGGTGG - Intronic
1148224801 17:45891836-45891858 GAGCCACGCCATTCTGGTGGCGG + Intergenic
1158096698 18:53780306-53780328 GAGGAAAGCCAATTTTATGAGGG - Intergenic
1160522275 18:79514608-79514630 GAGGCATGCCAGGGTGGTGGGGG - Intronic
1164933147 19:32190779-32190801 TAGGCAAGGGAATTTGGGGGGGG - Intergenic
926014581 2:9438377-9438399 CTGGCAACCCAATTTGATGGTGG - Intronic
927325463 2:21800299-21800321 GAGGCAAGCCTATCTGCTGGAGG + Intergenic
927978136 2:27356097-27356119 GAGGCAACTCACTTTGTTGGAGG - Exonic
929375822 2:41285755-41285777 GAGACAAGGCAATTTAATGGTGG + Intergenic
930812299 2:55555323-55555345 GTGCCAAGACAATTTGATGGGGG - Intronic
934038003 2:88104657-88104679 GAGGCAACCCGAGGTGGTGGGGG - Intronic
934178498 2:89598622-89598644 GAGGAAAGCAAACCTGGTGGTGG - Intergenic
934288793 2:91672907-91672929 GAGGAAAGCAAACCTGGTGGTGG - Intergenic
934564428 2:95330468-95330490 GAGGCAAGTGAAGTTGGTAGTGG - Intronic
935283818 2:101545711-101545733 GAGGCAAGCCCCTTTCATGGTGG + Intergenic
939843808 2:147220147-147220169 GAGCCTTGCCAGTTTGGTGGTGG - Intergenic
942383547 2:175418723-175418745 GAGTCAAGCCAAGGTGGTGGAGG + Intergenic
944573062 2:201063836-201063858 GATGGAAGCCATTTTGGAGGTGG + Intronic
945538143 2:211046369-211046391 GATGCAAGCCAATTCTGTGTGGG + Intergenic
1173838475 20:46140696-46140718 GAGGTAAGGCAACTTGCTGGAGG + Intergenic
1173856229 20:46252148-46252170 AAGGCAGGCATATTTGGTGGTGG - Intronic
1174170471 20:48614959-48614981 CAGGCAATCCAATCTGCTGGGGG + Intergenic
1176884175 21:14234283-14234305 GAAGGAAGCCAATGTAGTGGAGG + Intergenic
949939414 3:9143323-9143345 TAGGCAACCCACTTTGGTGCTGG - Intronic
950199162 3:11030660-11030682 GAGGGAAGCCAGAGTGGTGGAGG + Intronic
956263689 3:67374004-67374026 CAGTCAACCCAATTTGGAGGAGG - Intronic
959641439 3:108641792-108641814 GAGGAAAGGGATTTTGGTGGTGG - Intronic
960956344 3:123034104-123034126 GAGGAGAGACATTTTGGTGGGGG - Intergenic
962426364 3:135272144-135272166 GAGGCAGGCCACTTAGCTGGAGG + Intergenic
963827987 3:149975929-149975951 GAGGCAAGCCACTATGGGTGAGG - Intronic
964638382 3:158882326-158882348 GTGGCATGACCATTTGGTGGGGG - Intergenic
964877430 3:161384083-161384105 GATGCAACACAATTTAGTGGAGG + Intergenic
966065125 3:175812187-175812209 GTGGCAAGCCAATATGGCGATGG - Intergenic
966929034 3:184663875-184663897 GAGGCAAGCCTATGAGGCGGGGG + Intronic
969445500 4:7242712-7242734 GGGGAAAGCCACTTTGGAGGGGG - Intronic
971135506 4:23864070-23864092 GAGGGAAGCTAATGTGGTGGAGG - Intronic
975087806 4:70364662-70364684 GAGAAAAGCCAGTTTGGTGGGGG + Intronic
975089717 4:70387692-70387714 GAGAAAAGCCAGTTTGGTGGGGG + Intronic
976374670 4:84331472-84331494 GAGTCAGGCCAAGTTAGTGGAGG - Intergenic
977773057 4:100882149-100882171 GGGACAAGCATATTTGGTGGGGG + Intergenic
979025542 4:115569341-115569363 GAGGCAAGTCAATTTGGAAAAGG - Intergenic
985721030 5:1489108-1489130 CAGGCAGGCCAAATGGGTGGGGG + Intronic
987773482 5:22335864-22335886 GAGGCAAGCCACTTTGGAACTGG + Intronic
989151133 5:38300986-38301008 GAGTGAAGCAGATTTGGTGGTGG + Intronic
997759318 5:136429642-136429664 GATGCAAGCAATTTTGGAGGTGG + Intergenic
1002109811 5:176900842-176900864 GAGGAAAGGCAGTTTGCTGGGGG + Intergenic
1006799662 6:36751914-36751936 GAGGGAAGCAATTTTGATGGGGG + Intronic
1011256490 6:85427085-85427107 CAGGCCAGCCGATTTGCTGGGGG + Intergenic
1011614482 6:89185320-89185342 GTAGAAAGCCAGTTTGGTGGTGG + Exonic
1012033902 6:94107467-94107489 GAGGGAAGGAAGTTTGGTGGTGG + Intergenic
1014365446 6:120535221-120535243 GAGGCAAGATAATTTGGGGATGG - Intergenic
1016350079 6:143157295-143157317 GAGGCCACACAATGTGGTGGAGG - Intronic
1017456129 6:154603266-154603288 AAGGCCAGGCACTTTGGTGGGGG - Intergenic
1017744700 6:157436067-157436089 GAGGGAAGGCAAGTAGGTGGAGG + Intronic
1019897073 7:3990886-3990908 GAGGCAAGCTAACTGGCTGGAGG - Intronic
1020040410 7:4996946-4996968 GAGGAAAGCCAAGTGGATGGTGG - Intronic
1024938240 7:54734541-54734563 GAGGCAACCAAATTTTGGGGTGG + Intergenic
1027730327 7:81863523-81863545 AAGGTAGCCCAATTTGGTGGAGG + Intergenic
1028073315 7:86479111-86479133 GAGGCAAGTTACTTGGGTGGGGG - Intergenic
1028164069 7:87517847-87517869 GATGGAAGCCAATTTAGGGGAGG - Intronic
1029365162 7:100112009-100112031 GAGGGAAGCCAGTCAGGTGGGGG + Intronic
1033245188 7:139711984-139712006 GAGGCAAGTCTCTGTGGTGGTGG + Intronic
1033367698 7:140684079-140684101 GGGGCAAGCCATGTTGGTGTTGG + Intronic
1036506759 8:9363915-9363937 GTGGAAAGCCAATTTGCTGATGG + Intergenic
1047021563 8:120780236-120780258 GAGGCAAGCCAATTTGGTGGTGG - Intronic
1047394629 8:124484347-124484369 GAAGAAAGGCAATTTGGTGATGG + Intronic
1048455141 8:134570904-134570926 TAAGCAAGCCAATCTGCTGGGGG + Intronic
1048962174 8:139589785-139589807 GAGGTTAGGCATTTTGGTGGCGG - Intergenic
1049068371 8:140337672-140337694 TAGGCAGCCCATTTTGGTGGGGG - Intronic
1050841776 9:10158690-10158712 GTGGCAGGCAAATTTGGAGGAGG - Intronic
1055332519 9:75198745-75198767 GAGGCAATGGATTTTGGTGGGGG + Intergenic
1187996155 X:24929127-24929149 TAGCCAACCCAATTTGGTGCAGG - Intronic
1188994452 X:36866030-36866052 CAGGCAAGCCAACAAGGTGGAGG + Intergenic
1189393442 X:40598238-40598260 GTGGCATGCCACTTTCGTGGTGG + Intronic
1196211142 X:112997070-112997092 GATGGAAGCCAGTTTTGTGGAGG + Intergenic
1196973130 X:121131322-121131344 GTGGGATGGCAATTTGGTGGGGG + Intergenic
1199740824 X:150734550-150734572 GAGAAAAGCCATATTGGTGGAGG + Intronic
1201904086 Y:19072176-19072198 GAGGCAAGGATATTTGGTGGAGG - Intergenic