ID: 1047021664

View in Genome Browser
Species Human (GRCh38)
Location 8:120781657-120781679
Sequence ATTCATAAAAAGAGGTAGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1025
Summary {0: 1, 1: 0, 2: 1, 3: 43, 4: 980}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047021664_1047021667 -4 Left 1047021664 8:120781657-120781679 CCAACCTACCTCTTTTTATGAAT 0: 1
1: 0
2: 1
3: 43
4: 980
Right 1047021667 8:120781676-120781698 GAATTTCACAAAACAGAGAATGG No data
1047021664_1047021668 13 Left 1047021664 8:120781657-120781679 CCAACCTACCTCTTTTTATGAAT 0: 1
1: 0
2: 1
3: 43
4: 980
Right 1047021668 8:120781693-120781715 GAATGGACTCATTCTTATTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047021664 Original CRISPR ATTCATAAAAAGAGGTAGGT TGG (reversed) Intronic
904752252 1:32748293-32748315 ACTCAAAAAAAAAGGAAGGTGGG + Intronic
905721911 1:40211004-40211026 ATTTATAAAAACAGGTAGCTGGG - Intronic
906426115 1:45714237-45714259 ATTCCTTTGAAGAGGTAGGTTGG - Exonic
906644961 1:47468295-47468317 ATTCAATAAATTAGGTAGGTAGG - Intergenic
906790745 1:48656811-48656833 ATTCATAAAGAGGGGCAGGAGGG + Intronic
906834697 1:49070741-49070763 CTTCATAAAATGAGTTAGGGAGG + Intronic
907003690 1:50888873-50888895 CTTCATAAAATGAGTTAGGGAGG + Intronic
907683639 1:56588400-56588422 ATTCAAAATAAGATTTAGGTGGG + Intronic
907835266 1:58102687-58102709 ATTCATTAAAAGAAAAAGGTGGG - Intronic
908775484 1:67635491-67635513 AGTCCTTAAAAGAGTTAGGTAGG - Intergenic
908867286 1:68563295-68563317 TTTCATAGAAAGAGTTAGGGAGG + Intergenic
908969424 1:69809406-69809428 CTTCATAAAATGAGTTAGGGAGG - Intronic
909101262 1:71352295-71352317 ATTCAAGAAAAGATTTAGGTGGG - Intergenic
909370745 1:74880621-74880643 CCTCATAAAATGAGTTAGGTAGG - Intergenic
909396675 1:75178184-75178206 CTTCATAAAATGAGTTAGGGAGG + Intergenic
909414125 1:75385690-75385712 CTTCATAAAATGAGTTAGGGAGG - Intronic
909485768 1:76171967-76171989 CTTCATAAAATGAGTTAGGGAGG - Intronic
909697859 1:78487459-78487481 CTTCATAAAATGAGTTAGGGAGG - Intronic
909733977 1:78933060-78933082 CTTCATAAAATGAGCTAGGGAGG - Intronic
909765718 1:79353635-79353657 ATTCATAACTAGAGAGAGGTTGG + Intergenic
909813648 1:79962727-79962749 AGTAATAAAAAGATGGAGGTAGG + Intergenic
910314876 1:85871328-85871350 CCTCATAAAAAGAGTTAGGGAGG - Intronic
910620343 1:89246781-89246803 CTTCATAAAATGAGTTAGGGAGG - Intergenic
910717723 1:90250620-90250642 CCTCATAAAATGAGGTAGGGAGG - Intergenic
911022659 1:93404463-93404485 ACTCATAAAATGAGTTAGGGAGG + Intergenic
911079384 1:93913232-93913254 CTTCATAAAATGAGTTAGGAAGG + Intergenic
911159053 1:94665409-94665431 ATACATATAAAGAGGTATTTGGG - Intergenic
911243101 1:95486704-95486726 CCTCATAAAAAGAGTTAGGGAGG - Intergenic
911690143 1:100823691-100823713 CTTCATAAAATGAGTTAGGGAGG - Intergenic
912108718 1:106313698-106313720 ACTCATAAAATGAGTTAGGGAGG + Intergenic
912607935 1:111011622-111011644 CTTCATAAAATGAGTTAGGGAGG - Intergenic
912894483 1:113572402-113572424 ACTCATAAAATGAGTTAGGGAGG + Intronic
913388432 1:118284384-118284406 CCTCATAAAAAGAGTTAGGGAGG - Intergenic
913418837 1:118641371-118641393 ACTCATAAAATGAGTTAGGGAGG - Intergenic
913559180 1:120000864-120000886 ATTCATCAAAAGGTGTTGGTGGG - Intronic
913638685 1:120789678-120789700 ATTCATCAAAAGGTGTTGGTGGG + Intergenic
913720043 1:121583671-121583693 ATTCATAAAATGAGTTAGGGAGG + Intergenic
914279774 1:146160307-146160329 ATTCATCAAAAGGTGTTGGTGGG - Intronic
914383282 1:147140396-147140418 CCTCATAAAATGAGTTAGGTTGG + Intergenic
914391810 1:147230518-147230540 ACTCATAAAATGAGTTAGGGAGG + Intronic
914540812 1:148611225-148611247 ATTCATCAAAAGGTGTTGGTGGG - Intronic
914625828 1:149460021-149460043 ATTCATCAAAAGGTGTTGGTGGG + Intergenic
915375235 1:155388617-155388639 ATTGAGCAAAAGAGGAAGGTTGG - Intronic
915760547 1:158307566-158307588 CCTCATAAAATGAGTTAGGTAGG - Intergenic
916298710 1:163249492-163249514 TTTAATAAAATGAGGAAGGTCGG + Intronic
916878398 1:168995054-168995076 TTTCATAAAATGAGTTAGGGAGG + Intergenic
916908072 1:169311048-169311070 ATCCATAAAAGGAGAAAGGTTGG + Intronic
917060242 1:171029804-171029826 CTTCATAAAATGAGTTAGGGAGG + Intronic
917175748 1:172233522-172233544 ACTCATAAAATGAGTTAGGGAGG - Intronic
917356092 1:174127976-174127998 CTTCATAAAATGAGTTAGGGAGG + Intergenic
917405677 1:174704984-174705006 TTTCATAAAAATAGGAAAGTGGG + Intronic
917581894 1:176387281-176387303 CTTCATAAAATGAGTTAGGGAGG + Intergenic
917682438 1:177381404-177381426 CTTCATAAAATGAGTTAGGGAGG + Intergenic
918169141 1:181978917-181978939 CTTCATAAAATGAGCTAGGGAGG - Intergenic
918505944 1:185254288-185254310 CCTCATAAAAAGAGTTAGGGAGG + Intronic
918541890 1:185641531-185641553 CTTCATAAAATGAGTTAGGGAGG - Intergenic
918624388 1:186640826-186640848 CCTCATAAAAAGAGTTAGGGAGG - Intergenic
918801885 1:188983077-188983099 CTTCATAAAATGAGTTAGGAAGG + Intergenic
919031224 1:192245405-192245427 CTTCATAAAATGAGTTAGGGAGG + Intergenic
919537712 1:198809068-198809090 ATTGATAAAAAGAAATAGGGAGG - Intergenic
920534532 1:206729086-206729108 ATTCACAGAAAGAGGTAGAAAGG + Exonic
920551594 1:206866097-206866119 AATCATAAAAAGAGGCAGGCTGG + Intronic
920886055 1:209929110-209929132 ATTCAGAAAAAGAGGAAGGGAGG - Intergenic
921736087 1:218630299-218630321 CTTCATAAAATGAGTTAGGGAGG + Intergenic
921779774 1:219148878-219148900 ATTCATATAAAGAACTAGATTGG + Intergenic
922147367 1:222961100-222961122 CTTCATAAAATGAGTTAGGGAGG - Intronic
922373743 1:224939818-224939840 ATTCAGCAAGAGATGTAGGTGGG - Intronic
922387698 1:225104394-225104416 CTTCATAAAATGAGTTAGGGAGG + Intronic
923084047 1:230688699-230688721 ATTGATGAAGAGAGGGAGGTTGG + Intronic
923657295 1:235928926-235928948 CTTCATAAAATGAGTTAGGAAGG + Intergenic
924462857 1:244274691-244274713 AAAAATAAAAAGAGTTAGGTGGG - Intergenic
1063831723 10:9961211-9961233 ACTCATAAAATGAGTTAGGGAGG - Intergenic
1064296695 10:14085104-14085126 ATTTATAAACAGATGGAGGTGGG - Intronic
1065120280 10:22523061-22523083 ACTCATAAAATGAGTTAGGGAGG + Intergenic
1065830631 10:29610755-29610777 ATTCATGAAAAGATGGAGGTTGG - Intronic
1066014896 10:31231479-31231501 CTTCATAAAATGAGTTAGGAAGG - Intergenic
1066150656 10:32612932-32612954 CCTCATAAAATGAGTTAGGTGGG + Intronic
1066612461 10:37264420-37264442 TTCCATAAGAAGAGGTAGCTAGG + Intronic
1066784850 10:38992112-38992134 CTTCATAAAATGAGTTAGGGAGG + Intergenic
1067329115 10:45298070-45298092 CTTCATAAAATGAGTTAGGGAGG + Intergenic
1067333714 10:45345093-45345115 CCTCATAAAATGAGGTAGGGAGG - Intergenic
1067392822 10:45880732-45880754 ATTAAAAAAAAAAGTTAGGTGGG + Intergenic
1067861148 10:49849855-49849877 ATTAAAAAAAAAAGTTAGGTGGG + Intronic
1068126499 10:52847770-52847792 CTTCATAAAATGAGTTAGGGAGG + Intergenic
1068143287 10:53032162-53032184 ATTCTTAAAAAGAGGAAGGAGGG + Intergenic
1068214942 10:53970921-53970943 CTTCATAAAATGAGTTAGGGAGG - Intronic
1068490665 10:57719713-57719735 CCTCATAAAATGAGGTAGGGAGG - Intergenic
1068502474 10:57857507-57857529 CTTCATAAAATGAGTTAGGGGGG + Intergenic
1068718611 10:60216774-60216796 CTTCATAAAATGAGTTAGGGAGG + Intronic
1068835928 10:61553658-61553680 CTTCATAAAATGAGTTAGGAAGG - Intergenic
1070080856 10:73185934-73185956 CTTCATAGAATGAGTTAGGTAGG - Intronic
1070213526 10:74351060-74351082 CTTCATAAAATGAGTTAGGGAGG - Intronic
1071001685 10:80838261-80838283 CCTCATAAAAAGAGTTAGGGAGG + Intergenic
1071077246 10:81769723-81769745 ACTCATAAAATGAGTTAGGGAGG + Intergenic
1071134218 10:82434953-82434975 CTTCATAAAATGAGTTAGGGAGG + Intronic
1071763481 10:88635032-88635054 CTTCATAAAATGAGGTAGAGAGG + Intergenic
1072404717 10:95139525-95139547 CTTCATAAAATGAGTTAGGGAGG - Intergenic
1072541551 10:96402129-96402151 AATAATAAAAAGAGCTATGTGGG - Intronic
1072831916 10:98667409-98667431 CTTCATAAAATGAGTTAGGGAGG - Intronic
1072849708 10:98875660-98875682 CTTCATAAAATGAGTTAGGGAGG - Intronic
1073821174 10:107265984-107266006 ATTCAAAAATAGAGGAAGGGAGG - Intergenic
1073925280 10:108508003-108508025 ACTCATAAAATGAGTTAGGGAGG - Intergenic
1074282477 10:112065885-112065907 CCTCATAAAAAGAGTTAGGGAGG - Intergenic
1074325253 10:112444916-112444938 ATTAAAAAAAAGATGGAGGTGGG - Intronic
1074480191 10:113812718-113812740 CTTCATAAAATGAGTTAGGGAGG - Intergenic
1075842062 10:125513286-125513308 ATTCATGAAAAGAGTAAAGTAGG - Intergenic
1075854322 10:125615792-125615814 CTTCATAAAATGAGTTAGGGAGG + Intronic
1076845417 10:133066993-133067015 CTTCAAAAAAAGAGGAAGGCTGG + Intergenic
1077471674 11:2765302-2765324 ATCCATAAAAAGAGATAACTAGG - Intronic
1077591550 11:3495462-3495484 CCTCATAAAATGAGTTAGGTAGG + Intergenic
1078482983 11:11695488-11695510 CTTCATAAAATGAGTTAGGGAGG - Intergenic
1078744556 11:14099003-14099025 ATGAATAAAAACAGGTAGGTAGG - Intronic
1078809108 11:14740110-14740132 ACTCATAAAATGAGTTAGGGAGG + Intronic
1079316870 11:19415576-19415598 TCTCATAAAAAGAGTTAGGGAGG - Intronic
1079563342 11:21850304-21850326 CCTCATAAAATGAGGTAGGGAGG - Intergenic
1079579394 11:22044220-22044242 CCTCATAAAAAGAGTTGGGTTGG + Intergenic
1079690446 11:23410362-23410384 CTTCATAAAATGAGTTAGGTTGG + Intergenic
1079858295 11:25634573-25634595 ATTCAAAAGAAGATTTAGGTGGG + Intergenic
1079966061 11:26981411-26981433 CTTCATAAAATGAGTTAGGGAGG + Intergenic
1080033260 11:27684908-27684930 ACTCATAAAATGAGTTAGGGAGG + Intronic
1080079669 11:28201390-28201412 CTTCATAAAATGAGTTAGGGAGG + Intronic
1080949988 11:37020373-37020395 CCTCATAAAAAGAGTTAGGGAGG + Intergenic
1080968552 11:37243205-37243227 CCTCATAAAAAGAGTTAGGGAGG + Intergenic
1081405367 11:42691628-42691650 ACTCATAAAATGAGTTAGGGAGG - Intergenic
1081454073 11:43203739-43203761 CCTCATAAAAAGAGTTAGGGAGG + Intergenic
1081454625 11:43209216-43209238 CTTCATAAAATGAGTTAGGGAGG + Intergenic
1082151648 11:48747204-48747226 CATCATAAAAAGAGTTAGGGAGG + Intergenic
1082557831 11:54583824-54583846 CTTCATAAAATGAGTTAGGGAGG + Intergenic
1082568614 11:54711078-54711100 CCTCATAAAATGAGTTAGGTAGG + Intergenic
1082667276 11:55989500-55989522 CCTCATAAAAAGAGTTAGGGAGG - Intergenic
1082668766 11:56007997-56008019 ACTCATAAAATGAGTTAGGGAGG + Intergenic
1083501356 11:63111358-63111380 CTTCATAAAATGAGTTAGGGAGG + Intronic
1083562077 11:63681200-63681222 ATTCACATAAAGAGGCAGGAGGG + Intergenic
1084247248 11:67867211-67867233 CCTCATAAAATGAGTTAGGTAGG + Intergenic
1084825443 11:71727318-71727340 CTTCATAAAATGAGTTAGGTAGG - Intergenic
1086190921 11:84078242-84078264 GTTCATATAAACAGGTAGATGGG + Intronic
1086304782 11:85467819-85467841 CTTCATAAAATGAGTTAGGGAGG + Intronic
1086756762 11:90573425-90573447 ATTCAAAATAAGAGTTTGGTGGG + Intergenic
1086967653 11:93046519-93046541 CTTCATAAAATGAGTTAGGGAGG - Intergenic
1087306085 11:96490581-96490603 CTTCATAAAATGAGTTAGGGAGG - Intronic
1087868597 11:103264337-103264359 TCTCATAAAATGAGTTAGGTAGG - Intronic
1088004335 11:104922693-104922715 CCTCATAAAATGAGGTAGGGAGG + Intergenic
1088309831 11:108448266-108448288 CCTCATAAAAAGAGTTAGGGAGG - Intronic
1088359087 11:108972572-108972594 ATTCAGACAAAGGAGTAGGTGGG - Intergenic
1088418466 11:109616506-109616528 ATTTTTAAAATGAGGTTGGTTGG - Intergenic
1088948215 11:114536912-114536934 CTTCATAAAATGAGTTAGGGAGG - Intronic
1089285098 11:117401488-117401510 CTTCATAAAATGAGTTAGGGAGG + Intronic
1089600244 11:119609810-119609832 ATTCATAAAACCAGGCAGGCCGG - Intergenic
1090129892 11:124129488-124129510 CTTCATAAAATGAGTTAGGGAGG + Intronic
1090630305 11:128640939-128640961 ATTCATAAAATGAGTTACGGAGG - Intergenic
1090690228 11:129173451-129173473 CTTCATAAAATGAGTTAGGGAGG - Intronic
1091045748 11:132323658-132323680 ACTCATAAAATGAGTTAGGGAGG - Intronic
1091390590 12:123854-123876 ATTTATAAAAATGGGGAGGTTGG + Intronic
1092031234 12:5287453-5287475 CCTCATAAAAAGAGTTAGGGAGG + Intergenic
1092417675 12:8303574-8303596 CCTCATAAAATGAGTTAGGTAGG + Intergenic
1092442851 12:8524206-8524228 CTTCATAAAATGAGTTAGGGAGG + Intergenic
1093350517 12:18094230-18094252 CTTCATAAAATGAGTTAGGGAGG - Intronic
1093413319 12:18892730-18892752 CTTCATAAAATGAGTTAGGGAGG + Intergenic
1093721512 12:22447718-22447740 ATTCATAAAACAAGCCAGGTGGG - Intergenic
1093813746 12:23518163-23518185 ACTCATAAAATGAGTTAGGGAGG + Intergenic
1093941251 12:25057210-25057232 ATACATACAGATAGGTAGGTAGG + Intronic
1094159964 12:27380018-27380040 TTTCAGAAAATGAGGTAGGGAGG + Intronic
1094560920 12:31552572-31552594 CCTCATAAAAAGAGTTAGGGAGG + Intronic
1094758186 12:33496253-33496275 CTTCATAAAATGAGTTAGGTAGG - Intergenic
1095251824 12:39988468-39988490 ATTTAAAAAAAGAGGAAGGAAGG + Intronic
1095320042 12:40816159-40816181 CTTCATAAAATGAGTTAGGGAGG + Intronic
1095418905 12:42004967-42004989 AATCGTCAAAGGAGGTAGGTAGG + Intergenic
1095510006 12:42940972-42940994 CCTCATAAAATGAGTTAGGTAGG + Intergenic
1095931258 12:47627767-47627789 ACTCATAAAACGAGTTAGGTAGG - Intergenic
1096894701 12:54809454-54809476 CTTCATAAAATGAGTTAGGGAGG + Intergenic
1096942173 12:55358862-55358884 CCTCATAAAATGAGTTAGGTAGG - Intergenic
1097415515 12:59311441-59311463 CTTCATAAAATGAGTTAGGGAGG - Intergenic
1097528089 12:60763969-60763991 CTTCATAAAATGAGTTAGGGAGG + Intergenic
1097571607 12:61340071-61340093 ATTTCTAAAAATAGGTAGGCTGG - Intergenic
1097700233 12:62812581-62812603 ATTCCTGAATAGAAGTAGGTAGG - Intronic
1097935821 12:65250035-65250057 AATGAGAAAAAGAGGTAGCTGGG + Intergenic
1098200341 12:68047824-68047846 ATTCATAAAATGAGTTAGGGAGG + Intergenic
1098437042 12:70478962-70478984 CTTCATAAAATGAGTTAGGGAGG + Intergenic
1098439582 12:70503991-70504013 CTTCATAAAATGAGTTAGGGAGG + Intergenic
1098688025 12:73450775-73450797 AGTCATAAAAAAAAGAAGGTGGG - Intergenic
1099042248 12:77670421-77670443 CTTCATAAAATGATGTAGGGAGG - Intergenic
1099547905 12:84008410-84008432 CTTCATAAAATGAGTTAGGTAGG + Intergenic
1099720866 12:86359962-86359984 CCTCATAAAAAGAGTTAGGGAGG - Intronic
1099839396 12:87946818-87946840 CCTCATAAAATGAGTTAGGTAGG - Intergenic
1099878769 12:88440588-88440610 CCTCATAAAATGAGTTAGGTAGG - Intergenic
1100087309 12:90927440-90927462 CTTCATAAAATGAGTTAGGGAGG - Intronic
1100218683 12:92480483-92480505 ATACAAAAAAAAAGGTAGCTGGG + Intergenic
1100564153 12:95778793-95778815 ACTCATAAAATGAGTTAGGGAGG - Intronic
1100798337 12:98205611-98205633 CTTCATAAAATGAGTTAGGGAGG - Intergenic
1101056767 12:100925233-100925255 AAGCATAAAAATAGGTAGCTTGG + Intronic
1101206273 12:102491000-102491022 CTTCATAAAATGAGTTAGGGAGG + Intergenic
1101487617 12:105181469-105181491 CTTCATAAAATGAGTTAGGGAGG + Intronic
1101790431 12:107921564-107921586 TTTCATAAAATGAGTTAGGGAGG - Intergenic
1102944599 12:116974904-116974926 ATAAATAAAAAGATGAAGGTAGG + Intronic
1103115808 12:118330696-118330718 ATTCAAAAAAAGAGGTAAAGAGG + Intronic
1103203302 12:119107328-119107350 CTTCATAAAATGAGTTAGGGAGG + Intronic
1104507462 12:129345947-129345969 TTTCATAAAATGAGTTAGGGAGG + Intronic
1104668668 12:130665973-130665995 ATTCAGAAAAAGAGGGAGACAGG - Intronic
1105672353 13:22633566-22633588 CTTCATAAAATGAGTTAGGGAGG + Intergenic
1105748920 13:23403271-23403293 CTTCATAAAATGAGTTAGGGAGG + Intronic
1106215752 13:27697448-27697470 CTTCATAAAATGAGTTAGGGAGG + Intergenic
1106889892 13:34233710-34233732 CTTCATAAAATGAGTTAGGGAGG + Intergenic
1108130537 13:47294932-47294954 CTTCATAAAATGAGTTAGGGAGG + Intergenic
1108141578 13:47428065-47428087 AATAATAAAAAGGGGGAGGTGGG + Intergenic
1108144979 13:47467172-47467194 CTTCATAAAATGAGTTAGGGAGG - Intergenic
1108414394 13:50182809-50182831 CCTCATAAAAAGAGTTAGGGAGG + Intronic
1108491404 13:50985554-50985576 CCTCATAAAAAGAGTTAGGGAGG - Intergenic
1108529881 13:51318950-51318972 AATCATAAAAAGATGGAGGAAGG - Intergenic
1108628641 13:52257930-52257952 CCTCATAAAATGAGGTAGGGAGG - Intergenic
1108657417 13:52548520-52548542 CCTCATAAAATGAGGTAGGGAGG + Intergenic
1108954412 13:56134673-56134695 ATGCATAAAAATAGGTAGAATGG - Intergenic
1109553498 13:63937613-63937635 CTTCATAAAATGAGTTAGGGAGG - Intergenic
1109814732 13:67565555-67565577 AATAATAAAAAGAGCAAGGTAGG - Intergenic
1109884686 13:68526772-68526794 ACTCATAAAATGAGTTAGGGAGG - Intergenic
1109977089 13:69852665-69852687 GTTGATCAAAAGAGGTATGTTGG - Intronic
1110390061 13:74963067-74963089 CTTCATAAAAAGAGTTAGGGAGG - Intergenic
1110402642 13:75111808-75111830 CTTCATAAAATGAGCTAGGGAGG - Intergenic
1110545547 13:76751358-76751380 AATCATCAAAAGTGCTAGGTTGG - Intergenic
1110610792 13:77485685-77485707 TTTAATAAAAAGAGGGAAGTGGG + Intergenic
1110768103 13:79303542-79303564 TTTCATAAAATGAGTTAGGGAGG - Intergenic
1111092526 13:83465446-83465468 CTTCATAAAACGAGTTAGGGAGG - Intergenic
1111209174 13:85053697-85053719 ATTCATATAAACAAGTACGTAGG - Intergenic
1111600808 13:90471683-90471705 CTTCATAAAATGAGTTAGGGAGG + Intergenic
1111908080 13:94278945-94278967 CTTCATAAAATGAGTTAGGGAGG + Intronic
1112745793 13:102525647-102525669 CTTCATAAAATGAGTTAGGGTGG - Intergenic
1114147048 14:19989656-19989678 TTTCATAGAAGGAGTTAGGTAGG - Intergenic
1114695099 14:24619911-24619933 CTTCATAAAATGAGTTAGGGAGG + Intergenic
1114807440 14:25854424-25854446 CTTCATAAAATGAGTTAGGGAGG + Intergenic
1114828534 14:26109894-26109916 CCTCATAAAAAGAGTTAGGGAGG - Intergenic
1114843907 14:26298087-26298109 CCTCATAAAAAGAGTTAGGGAGG - Intergenic
1115000380 14:28414528-28414550 CCTCATAAAATGAGGTAGGGAGG - Intergenic
1115135330 14:30101061-30101083 CCTCATAAAATGAGGTAGGGAGG - Intronic
1115517079 14:34196177-34196199 CTTCCTAAGAAGAGGTATGTGGG + Intronic
1116075293 14:40103164-40103186 CTTCATAAAATGAGTTAGGGAGG - Intergenic
1116085604 14:40233719-40233741 ATTCATAACAAGAGGAATTTTGG - Intergenic
1116193245 14:41686968-41686990 TTTCATAAAATGAGTTAGGGAGG + Intronic
1116212416 14:41965327-41965349 CCTCATAAAATGAGGTAGGGAGG + Intergenic
1116273035 14:42796771-42796793 CTTCATAAAATGAGTTAGGAAGG + Intergenic
1116305851 14:43255362-43255384 CCTCATAAAATGAGTTAGGTAGG - Intergenic
1116306686 14:43265553-43265575 CCTCATAAAATGAGTTAGGTAGG - Intergenic
1116992383 14:51290059-51290081 AATAATCAACAGAGGTAGGTAGG + Intergenic
1117720548 14:58624758-58624780 ATTTATAAAAATAGGTAGAAGGG - Intergenic
1117889776 14:60406951-60406973 CTTCATAAAATGAGTTAGGGAGG + Intronic
1117890571 14:60417629-60417651 ATGCATTAAAGGAGGTAGGAAGG + Intronic
1118119797 14:62827931-62827953 AAACATAAAAAGAGGTATGAAGG - Intronic
1118519106 14:66561250-66561272 CCTCATAAAATGAGGTAGGGAGG + Intronic
1118942600 14:70351890-70351912 ATTTATATAAAAAGGAAGGTAGG + Intronic
1119414276 14:74459218-74459240 ATGCATAAAAACAGGTGGCTGGG + Intergenic
1120066080 14:80042436-80042458 CTTCATAAAATGAGTTAGGGAGG - Intergenic
1120120255 14:80670403-80670425 ATGTATATAAATAGGTAGGTAGG - Intronic
1120478608 14:85020884-85020906 CCTCATAAAAAGAGTTAGGGAGG + Intergenic
1120567394 14:86077002-86077024 CTTCATAAAATGAGTTAGGGGGG + Intergenic
1120569357 14:86098447-86098469 CTTCATAAAATGAGTTAGGGAGG + Intergenic
1120570213 14:86107976-86107998 CTTCATAAAATGAGTTAGGGAGG + Intergenic
1121213689 14:92229945-92229967 CCTCATAAAAAGAGTTAGGGAGG + Intergenic
1123148808 14:106160984-106161006 CTTCATAAAAAGAGTTAGGGAGG + Intergenic
1123228209 15:17070655-17070677 CTTCATAAAATGAGTTAGGGAGG + Intergenic
1123481153 15:20632707-20632729 CTTCATAAAATGAGTTAGGGTGG - Intergenic
1123636858 15:22367658-22367680 CTTCATAAAATGAGTTAGGGTGG + Intergenic
1124404954 15:29384241-29384263 ATTCACAAAAAGAAGAAAGTGGG - Intronic
1125272656 15:37956722-37956744 CTTCATAAAATGAGTTAGGGAGG - Intronic
1125332625 15:38597200-38597222 ATTCATCACAAGAGTTCGGTGGG + Intergenic
1125917692 15:43503852-43503874 ATTCAGAAAAAAAGGGTGGTTGG + Intronic
1126177875 15:45755021-45755043 CTTCATAAAATGAGTTAGGGAGG + Intergenic
1126278128 15:46909042-46909064 CTTCATAAAATGAGTTAGGAAGG + Intergenic
1126365701 15:47892150-47892172 CCTCATAAAATGAGTTAGGTAGG + Intergenic
1126470385 15:49003948-49003970 CCTCATAAAATGAGTTAGGTAGG + Intronic
1126951815 15:53890062-53890084 CTTCATAAAATGAGTTAGGGAGG + Intergenic
1127062971 15:55206282-55206304 ATTTATAAAAAGATATAAGTAGG + Intronic
1127105126 15:55605553-55605575 CTTCATAAAATGAGTTAGGGAGG - Intergenic
1127524708 15:59781178-59781200 ATTCATACAATGAGTTAGGGAGG + Intergenic
1127748293 15:62004029-62004051 ACTCATAAAATGAGTTAGGGAGG + Intronic
1127749439 15:62018796-62018818 ACTCATAAAATGAGTTAGGGAGG + Intronic
1128857164 15:71028454-71028476 CTTCATAAAATGAGTTAGGGAGG + Intronic
1129132287 15:73510952-73510974 CTTCATAAAATGAGTTAGGGAGG + Intronic
1129134465 15:73534662-73534684 CTTCATAAAATGAGTTAGGGAGG - Intronic
1130001019 15:80046816-80046838 AATCATAAAGAGGGGAAGGTTGG - Intergenic
1130261873 15:82360827-82360849 ATTTATAAAAAGAGGCAGCATGG - Intergenic
1130279362 15:82508184-82508206 ATTTATAAAAAGAGGCAGCATGG + Intergenic
1130452939 15:84075713-84075735 CTTCATAAAATGAGTTAGGGAGG - Intergenic
1132504472 16:300494-300516 ATTAAAATATAGAGGTAGGTGGG - Intronic
1132839790 16:1973451-1973473 ATAAGTAAAAAGAGGTAGGTAGG + Intronic
1133812494 16:9171499-9171521 ATACATATAAATAGGTAGGATGG + Intergenic
1134758220 16:16688433-16688455 CTTCATAAAATGAGTTAGGGAGG + Intergenic
1134987853 16:18670744-18670766 CTTCATAAAATGAGTTAGGGAGG - Intergenic
1135225468 16:20652885-20652907 CCTCATAAAAAGAGTTAGGGAGG - Intronic
1135861763 16:26062551-26062573 ATTCCGAAATAGAGGAAGGTAGG - Intronic
1135869745 16:26138343-26138365 AAGCATAAAAGGAGGTAGGAGGG - Intergenic
1136486997 16:30579786-30579808 AATGAACAAAAGAGGTAGGTGGG - Intronic
1136645704 16:31612535-31612557 CTTCATAAAATGAGTTAGGGAGG - Intergenic
1136647266 16:31632375-31632397 CTTCATAAAATGAGTTAGGGAGG + Intergenic
1136681421 16:31966629-31966651 CTTCATAAAAAGAGTTAGAGAGG - Intergenic
1136781730 16:32908139-32908161 CTTCATAAAAAGAGTTAGAGAGG - Intergenic
1136888063 16:33945713-33945735 CTTCATAAAAAGAGTTAGAGAGG + Intergenic
1136899741 16:34022288-34022310 CTTCATAAAATGAGTTAGGGAGG - Intergenic
1136908619 16:34126828-34126850 CTTCATAAAATGAGTTAGGGAGG + Intergenic
1136983338 16:35078400-35078422 CTTCATAAAATGAGTTAGGGAGG - Intergenic
1137224149 16:46486249-46486271 ATTCATAGAATGAGTTAGGGAGG - Intergenic
1137356568 16:47771678-47771700 CCTCATAAAAAGAGTTAGGGAGG + Intergenic
1137390729 16:48079313-48079335 ATTTATAAAAACAGGTGGGCTGG + Intergenic
1138646353 16:58428126-58428148 AGCCATAAAAAGATGGAGGTAGG - Intergenic
1139083438 16:63554825-63554847 ATTGATAAAGATAGGTAGATCGG + Intergenic
1139169321 16:64612037-64612059 ATTCATAAAATGAGTTAGGGAGG + Intergenic
1139819757 16:69711989-69712011 ATTTCTATAAAGAGGGAGGTTGG - Intronic
1141995098 16:87631751-87631773 GATCAAAAAAAGAGGTAGGTAGG - Intronic
1203084386 16_KI270728v1_random:1172125-1172147 CTTCATAAAAAGAGTTAGAGAGG - Intergenic
1144294348 17:13859075-13859097 ACTCATAAAATGAGTTAGGGAGG - Intergenic
1144364804 17:14532629-14532651 ACTCATAAAATGAGTTAGGGAGG + Intergenic
1146760535 17:35473662-35473684 CTTCATAAAATGAGTTAGGCAGG + Intronic
1148474529 17:47918826-47918848 ATTTACAAAAACAGGCAGGTGGG - Intronic
1148952906 17:51330086-51330108 CCTCATAAAATGAGTTAGGTAGG - Intergenic
1149143833 17:53466034-53466056 ATGCATAAACAGAGGAAGGAAGG + Intergenic
1149241839 17:54660038-54660060 CTTCATAAAATGAGTTAGGGAGG + Intergenic
1149826385 17:59832405-59832427 AAACAAAAAAAGAAGTAGGTTGG - Intronic
1150529009 17:65957509-65957531 ATTCAGAAAAAAAGGAAAGTAGG - Intronic
1150796659 17:68243785-68243807 ATTCAAAAAAAGATCAAGGTTGG + Intergenic
1150843771 17:68634281-68634303 ATAAAGAAAAAGAGGTGGGTGGG - Intergenic
1151005757 17:70434101-70434123 ATTCAAAAAGATAAGTAGGTGGG + Intergenic
1151251345 17:72837985-72838007 ATTCAGGAATAGTGGTAGGTTGG + Intronic
1153025070 18:665027-665049 CTTCATAAAATGAGTTAGGGAGG + Intronic
1153418979 18:4883025-4883047 CTTCATAAAATGAGTTAGGGAGG + Intergenic
1155395566 18:25383109-25383131 CTTCATAAAAAGAGTTAGGTAGG - Intergenic
1155677677 18:28449409-28449431 ATGCATAAAAATATGTTGGTAGG - Intergenic
1155762237 18:29583050-29583072 GTTCATAAAAAGAAGTAAATTGG - Intergenic
1156433243 18:37098583-37098605 GCTCATAAAATGAGTTAGGTAGG + Intronic
1156709680 18:39927881-39927903 CCTCATAAAATGAGGTAGGGAGG - Intergenic
1157037054 18:43987663-43987685 ACTCATAAAATGAGTTAGGGAGG - Intergenic
1157397013 18:47350737-47350759 CTTCATAAAATGAGTTAGGGAGG + Intergenic
1157404056 18:47408869-47408891 ATTCATAACAAGAGGGAGGAGGG + Intergenic
1157525615 18:48378135-48378157 TTTCAAAAAAAAAGGAAGGTTGG + Intronic
1157898708 18:51492930-51492952 CTTCATAAGAAGAGGTATCTTGG - Intergenic
1158003563 18:52646673-52646695 ATTCAGATAAAGAGGTACATAGG + Intronic
1158105323 18:53879375-53879397 CTTCATAAAATGAGATAGGAAGG + Intergenic
1159149288 18:64499484-64499506 ATTCACAAAAAGAGGTCTTTTGG + Intergenic
1159199860 18:65170002-65170024 CTTCATAAAATGAGTTAGGGAGG - Intergenic
1159537227 18:69729570-69729592 ATTCCCAAAATGAGGTAGATGGG + Intronic
1159846856 18:73471276-73471298 CTTCATAAAATGAGTTAGGGAGG + Intergenic
1160275468 18:77429455-77429477 CTTCATAAAATGAGTTAGGGAGG + Intergenic
1160289808 18:77581378-77581400 CTTCATAAAATGAGTTAGGGAGG - Intergenic
1161551519 19:4915414-4915436 ATTTATAAAAACAGGTATGGCGG + Intronic
1164421235 19:28094967-28094989 TTACATACAAAGAGGGAGGTGGG + Intergenic
1165299912 19:34962111-34962133 GTTAAAAAAAAGAGGAAGGTGGG - Intronic
925053694 2:838220-838242 CTTCATAAAATGAGTTAGGGAGG - Intergenic
926647437 2:15304856-15304878 ATTCACAAAAAGAGATGGTTTGG + Intronic
926650933 2:15344644-15344666 CTTCATAAAATGAGTTAGGGAGG - Intronic
926925743 2:17985635-17985657 CTTCATAAAATGAGTTAGGGAGG + Intronic
926928687 2:18014522-18014544 CTTCATAAAATGAGTTAGGGAGG + Intronic
927117578 2:19920212-19920234 CTTCATAAAATGAGTTAGGGAGG - Intronic
927239452 2:20907983-20908005 CTTCATAAAATGAGTTAGGGAGG + Intergenic
927311736 2:21639281-21639303 ATTCATATAAAGAAATAGCTGGG + Intergenic
927381151 2:22480422-22480444 AGTCTTAAAAAGAGGCAGGCAGG + Intergenic
928473235 2:31595686-31595708 CTTCATAAAATGATGTAGGGAGG - Intergenic
928833249 2:35514173-35514195 ACTCATAAAATGAGTTAGGGAGG + Intergenic
929206289 2:39297863-39297885 ATTCATCAAAAAATGAAGGTTGG + Intronic
929232864 2:39577525-39577547 CTTCATAAAACGAGTTAGGGAGG + Intergenic
929258074 2:39835157-39835179 AATCATAGAATGAGTTAGGTAGG + Intergenic
929294822 2:40235108-40235130 CTTCATAAAATGAGTTAGGGAGG + Intronic
929635991 2:43521252-43521274 ATGCACAAAAAGAGGTAGGGAGG + Intronic
929837123 2:45413318-45413340 ATTTATGAAAAGGGGAAGGTTGG + Intronic
930546127 2:52769412-52769434 CTTCATAAAATGAGTTAGGGAGG - Intergenic
930861572 2:56079588-56079610 CTTCATAAAATGAGTTAGGGAGG - Intergenic
930962006 2:57273360-57273382 ACTCATAAAATGAGTTAGGGAGG + Intergenic
931492440 2:62763070-62763092 ATGCATGAAAAGAGGTATCTAGG - Intronic
931573826 2:63698734-63698756 ACTCAGAAAAAGAGGGAGGGGGG + Intronic
931675985 2:64696725-64696747 ATTCAGATAAACAGGCAGGTGGG - Intronic
931815224 2:65893901-65893923 CCTCATAAAAAGAGTTAGGGAGG - Intergenic
931843687 2:66180671-66180693 CCTCATAAAAAGAGTTAGGGAGG - Intergenic
932013873 2:68004462-68004484 CTTCATAAAATGAGTTAGGGAGG - Intergenic
932643990 2:73482587-73482609 CCTCATAAAAAGAGTTAGGGAGG + Intronic
932985857 2:76725347-76725369 CTTCATAAAATGAGTTAGGGAGG + Intergenic
933509196 2:83218489-83218511 ATTAATAAAAACAGGTAGTTTGG - Intergenic
934802165 2:97175135-97175157 CTTCATAAAATGAGTTAGGGAGG + Intronic
935010606 2:99132131-99132153 ACTCATAAAATGAGTTAGGGAGG + Intronic
935014200 2:99164478-99164500 ACTCATAAACAGAGGGAGCTGGG - Intronic
935049373 2:99511310-99511332 CTTCTTAAAAAGATGTATGTTGG + Intergenic
935436552 2:103041453-103041475 CTTCATAAAATGAATTAGGTAGG - Intergenic
936701926 2:115021643-115021665 CTTCATAAAACGATTTAGGTAGG - Intronic
936763374 2:115813800-115813822 ATTCACATAAAGAGGAAGGCGGG + Intronic
936873346 2:117159519-117159541 CCTCATAAAAAGAGTTAGGGAGG - Intergenic
937467133 2:122143447-122143469 ACTCATAAAATGAGTTAGGGAGG + Intergenic
937644572 2:124251815-124251837 TTTCATAAATACAGGCAGGTAGG - Intronic
937931890 2:127212300-127212322 CTTCATAAAATGAGTTAGGGGGG - Intronic
938136502 2:128762715-128762737 CTTCATAAAATGAGTTAGGGAGG + Intergenic
938156533 2:128945820-128945842 CTTCATAAAATGAGTTAGGGAGG + Intergenic
938337924 2:130515604-130515626 AATCATTAAAACTGGTAGGTTGG + Intergenic
938351915 2:130605134-130605156 AATCATTAAAACTGGTAGGTTGG - Intergenic
938734188 2:134171571-134171593 ATACTTAAAAATAGCTAGGTGGG - Intronic
938874107 2:135515145-135515167 CCTCATAAAATGAGTTAGGTAGG + Intronic
939164726 2:138627994-138628016 ATGTATAAAAAGAGGTATATGGG - Intergenic
939192558 2:138932960-138932982 TTTCATAAAATGAGCTAGGGAGG - Intergenic
939206378 2:139109185-139109207 CTTCATAAAATGAGTTAGGGAGG - Intergenic
939266472 2:139879900-139879922 CTTCATAAAATGAGTTAGGGAGG - Intergenic
939318534 2:140584460-140584482 ATTTATACAATGAGGCAGGTAGG + Intronic
939391471 2:141574077-141574099 CTTCATAAAATGAGTTAGGGAGG - Intronic
939809299 2:146811501-146811523 CTTCATAAAATGAGTTAGGGAGG - Intergenic
939862874 2:147440441-147440463 ATACATACATAGAGATAGGTGGG + Intergenic
940208215 2:151228051-151228073 ATTCACAATCAGAAGTAGGTGGG + Intergenic
940560771 2:155292981-155293003 CTTCATAAAATGAGTTAGGGAGG + Intergenic
940845335 2:158635156-158635178 ATTCATTAAAACAAGTTGGTAGG - Intronic
941242412 2:163055660-163055682 CTTTATAAAAAGAGGGACGTTGG - Intergenic
941832052 2:169972396-169972418 CCTCATAAAAAGAGTTAGGGAGG - Intronic
941845650 2:170129555-170129577 GTTCATAAAATGATGTAGGGAGG - Intergenic
942136684 2:172933128-172933150 ATTCACAAAAACAGGAAGCTGGG + Intronic
942399920 2:175591061-175591083 CCTCATAAAAAGAGTTAGGGAGG + Intergenic
942409329 2:175691749-175691771 CTTCATAAAATGAGTTAGGGAGG + Intergenic
942506521 2:176647091-176647113 ATTCAAAGAAAGATATAGGTAGG - Intergenic
942685732 2:178529951-178529973 ATTAACAATAAAAGGTAGGTTGG - Exonic
943112632 2:183624873-183624895 CTTCATAAAAAGAGGTAATTTGG - Intergenic
943130290 2:183845540-183845562 CTTCATAAAATGAGTTAGGGAGG - Intergenic
943255449 2:185588397-185588419 CTTCATAAAATGAGTTAGGGAGG + Intergenic
943284184 2:185976234-185976256 CCTCATAAAAAGAGTTAGGGAGG + Intergenic
943296416 2:186145970-186145992 CTTCATAAAATGAGTTAGGGAGG - Intergenic
943384678 2:187186508-187186530 CTTCATAAAATGAGTTAGGGAGG + Intergenic
943514365 2:188865897-188865919 CTTCATAAAATGAGTTAGGGAGG - Intergenic
943898934 2:193407073-193407095 CTTCATAAAATGAGTTAGGGAGG - Intergenic
944310135 2:198224103-198224125 ATTTATAAAAATGGGTGGGTAGG + Intronic
945164647 2:206930006-206930028 CCTCATAAAAAGAGTTAGGGAGG - Intergenic
945247490 2:207732109-207732131 ATTCATTCAAAGTGGAAGGTGGG - Intronic
945349529 2:208760913-208760935 CTTCATAAAATGAGTTAGGGAGG + Intronic
945481846 2:210354238-210354260 CTTCATAAAATGAGTTAGGGAGG - Intergenic
945615268 2:212058422-212058444 CTTCATAAAATGAGTTAGGGAGG - Intronic
946064970 2:216979229-216979251 CTTCATAAAATGAGCTAGGAAGG + Intergenic
946577423 2:221090799-221090821 CCTCATAAAATGAGTTAGGTAGG + Intergenic
946600501 2:221355211-221355233 ATTCATAATAAGATTTGGGTGGG + Intergenic
946974088 2:225128647-225128669 CTTCATAAAATGAGTTAGGGAGG - Intergenic
947479848 2:230489030-230489052 CTTCATAAAATGAGTTAGGGAGG + Intronic
948181697 2:235986981-235987003 CTTCATAAAATGAGTTAGGGAGG + Intronic
1170076504 20:12425182-12425204 CTTCATAAAATGAGTTAGGGAGG + Intergenic
1170496918 20:16934252-16934274 CTTCATAAAATGAGTTAGGGAGG - Intergenic
1171004402 20:21450111-21450133 ATACCTGAAAAGAGGTAGGAAGG - Intergenic
1171200626 20:23238681-23238703 CTTCATAAAATGAGTTAGGGAGG + Intergenic
1171246875 20:23617850-23617872 CTTCATAAAATGAGTTAGGGAGG + Intergenic
1171397536 20:24846934-24846956 CTTCATAAAACGAGTTAGGGAGG + Intergenic
1171404847 20:24904090-24904112 CATCATAAAAAGAGTTAGGGAGG - Intergenic
1171434406 20:25108877-25108899 CTTCATAAAATGAGTTAGGGAGG - Intergenic
1171454925 20:25263913-25263935 ACTCATAAAATGAGTTAGGGAGG - Intronic
1171893098 20:30734733-30734755 CTTCATAAAATGAGTTAGGGAGG - Intergenic
1171910395 20:30946622-30946644 ACTCATAAAATGAGTTAGGGAGG + Intergenic
1173412101 20:42821045-42821067 CTTCATAAAATGAGTTAGGGAGG - Intronic
1173442048 20:43086359-43086381 ATTCTTAAAAGGATGTAGGGTGG - Intronic
1174790778 20:53476141-53476163 CCTCATAAAAAGAGTTAGGGAGG - Intronic
1174937292 20:54884668-54884690 ACTCATAAAATGAGTTAGGGAGG + Intergenic
1174963307 20:55182568-55182590 ATTCTTAATAAAAGGTAGTTTGG + Intergenic
1175591680 20:60197924-60197946 ACTCATAAAATGAGTTAGGGAGG + Intergenic
1175602148 20:60283283-60283305 ATTTATTAAAAAAGGTAGGAAGG + Intergenic
1175754621 20:61521702-61521724 ATTCATAATAAGAGGGGGGTGGG + Intronic
1176325023 21:5387345-5387367 CTTCATAAAATGAGTTAGGGAGG + Intergenic
1176482578 21:7317761-7317783 CTTCATAAAATGAGTTAGGGAGG + Intergenic
1176761730 21:10803808-10803830 CTTCATAAAATGAGTTAGGGAGG + Intergenic
1177092228 21:16783414-16783436 CTTCATAAAATGAGTTAGGGAGG - Intergenic
1177158762 21:17525024-17525046 ATTGATAAAAAAAGGAAGATAGG + Intronic
1177372365 21:20220546-20220568 AGTGAAAAAAAGAGGTAGATAGG - Intergenic
1177511022 21:22088518-22088540 CTTCATAAAATGAGTTAGGGAGG + Intergenic
1178057196 21:28812646-28812668 ACTCATAAAATGAGTTAGGGAGG + Intergenic
1178423632 21:32461461-32461483 ATGCAGAAAAAGAGGCAGGAAGG - Intronic
1178965457 21:37112673-37112695 CTTCATAAAATGAGTTAGGGAGG - Intronic
1180401420 22:12432483-12432505 CTTCATAAAATGAGTTAGGGAGG + Intergenic
1181353491 22:22279302-22279324 CCTCATAAAAAGAGTTAGGGAGG + Intergenic
1181869343 22:25885698-25885720 ATTTTCAAAAAGAGGTATGTGGG + Intronic
1182204853 22:28613431-28613453 CTTCATTAAATGAGGTAGGGAGG - Intronic
1183703528 22:39463184-39463206 ATGCATAGAAAGTGGTTGGTTGG - Intronic
1183720013 22:39557305-39557327 ATGAGTAAAAAGAGGTGGGTGGG - Intergenic
1184809386 22:46819746-46819768 TTTCATAAAATGAGTTAGGGAGG + Intronic
949173602 3:1032401-1032423 CCTCATAAAATGAGGTAGGGAGG + Intergenic
949175720 3:1060335-1060357 CTTCATAAAATGAGTTAGGGAGG + Intergenic
949239452 3:1852476-1852498 CTTCATAAAATGAGTTAGGGAGG + Intergenic
949804333 3:7937841-7937863 CCTCATAAAATGAGGTAGGGAGG - Intergenic
950411998 3:12844612-12844634 ATTCATAATGAGATTTAGGTGGG - Intronic
950952356 3:17013767-17013789 AATCATAATAAGAGTCAGGTGGG - Intronic
950995465 3:17491808-17491830 CTTCATAAAATGAGTTAGGGAGG + Intronic
951042380 3:18002201-18002223 CTTCATAAAATGAGTTAGGGAGG + Intronic
951759222 3:26126971-26126993 CTTCATAAAATGAGTTAGGGAGG + Intergenic
951919575 3:27839346-27839368 ATTAATAACAAGAGGAAGGTGGG + Intergenic
952503397 3:33985692-33985714 CTTCATAAAATGAGTTAGGGAGG + Intergenic
952697500 3:36285509-36285531 ATTTGTAAAAAGAGGTATTTTGG - Intergenic
953087594 3:39686075-39686097 ATTAATAAAAAGAGGAATTTTGG + Intergenic
954056429 3:48029701-48029723 CGTAGTAAAAAGAGGTAGGTCGG + Intronic
954119006 3:48483870-48483892 ATTCAAAAAATTAGCTAGGTGGG - Intronic
954309072 3:49750537-49750559 ATACAAAAAAAAAGGTAGCTGGG + Intronic
954525344 3:51265333-51265355 ATTCATAAAATGAGTTCGGGAGG - Intronic
954563221 3:51576356-51576378 CCTCATAAAATGAGTTAGGTAGG + Intronic
954828261 3:53394769-53394791 CTTCATAAAATGAGTTAGGGAGG - Intergenic
955030563 3:55212740-55212762 CTTCATAAAATGAGTTAGGGAGG - Intergenic
955464589 3:59223340-59223362 CCTCATAAAATGAGTTAGGTAGG + Intergenic
955901639 3:63762328-63762350 ATTCATACAAAGAGTTAAGTGGG - Intergenic
956241744 3:67138515-67138537 CTTCATAAAATGAGTTAGGGAGG + Intergenic
957010921 3:75005392-75005414 ACTCATAAAATGAGTTAGGGAGG + Intergenic
957101507 3:75834273-75834295 CTTCATAAAATGAGTTAGGGAGG + Intergenic
957130510 3:76217794-76217816 CCTCATAAAATGAGGTAGGGAGG - Intronic
957143775 3:76395954-76395976 CCTCATAAAATGAGGTAGGGAGG - Intronic
957267692 3:77987645-77987667 CTTCATAAAATGAGTTAGGGAGG + Intergenic
957478558 3:80759259-80759281 ATTCACAGAAATAGGTGGGTTGG - Intergenic
958030088 3:88098463-88098485 CCTCATAAAAAGAGTTAGGGAGG - Intronic
958046913 3:88296130-88296152 CTTCATAAAATGAGTTAGGGAGG + Intergenic
958072929 3:88637873-88637895 CTTCATAAAATGAGTTAGGGAGG + Intergenic
958205395 3:90384957-90384979 CCTCATAAAAAGAGTTAGGGAGG + Intergenic
958412592 3:93835875-93835897 CTTCATAAAATGAGTTAGGGAGG - Intergenic
958447933 3:94237836-94237858 CCTCATAAAAAGAGTTAGGGAGG + Intergenic
958667080 3:97154953-97154975 AGTCATACAAACAGCTAGGTTGG - Intronic
958811238 3:98862351-98862373 CCTCATAAAAAGAGTTAGGGAGG - Intronic
958826608 3:99038406-99038428 CCTCATAAAAAGAGTTAGGGAGG - Intergenic
958828530 3:99061174-99061196 CCTCATAAAAAGAGTTAGGGAGG + Intergenic
958972360 3:100626018-100626040 CTTCATAAAATGAGCTAGGGAGG + Intronic
959097098 3:101967902-101967924 CTTCATAAAATGAGTTAGGGAGG + Intergenic
959408715 3:105994587-105994609 CTTCATAAAATGAGTTAGGGAGG - Intergenic
959418039 3:106101041-106101063 CTTCATAAAATGAGTTAGGGAGG + Intergenic
959505021 3:107147715-107147737 CTTCATAAAATGAGTTAGGGAGG - Intergenic
959522616 3:107337335-107337357 CTTCATAAAATGAGTTAGGGAGG - Intergenic
959856674 3:111166903-111166925 TTTAATAAAGATAGGTAGGTAGG + Intronic
960177627 3:114535623-114535645 CCTCATAAAAAGAGTTAGGGAGG - Intronic
960278516 3:115754524-115754546 CCTCATAAAAAGAGTTAGGGAGG - Intergenic
960407801 3:117283512-117283534 AGTGATAAAAAGAGGTAGAAAGG - Intergenic
960560258 3:119075458-119075480 CTTCATAGAATGAGTTAGGTAGG - Intronic
960580159 3:119270822-119270844 CTTCATAAAATGAGTTAGGGAGG - Intergenic
960716628 3:120582121-120582143 CTTCATAAAATGAGTTAGGGAGG - Intergenic
960746742 3:120898718-120898740 CTTCATAAAATGAGTTAGGGAGG + Intergenic
960755322 3:121005060-121005082 CTTCATAAAATGAGTTAGGGAGG + Intronic
960772829 3:121213722-121213744 CCTCATAAAAAGAGTTAGGGAGG + Intronic
960890932 3:122447152-122447174 CCTCATAAAATGAGTTAGGTAGG - Intronic
960902352 3:122565110-122565132 ATTCATAAAAAAAGGCAGGAAGG - Intronic
960929782 3:122835192-122835214 CTTCATAAAATGAGTTAGGGAGG - Intronic
961244930 3:125442742-125442764 CATCATAAAAAGAGGTGGGAGGG + Intergenic
961257664 3:125570801-125570823 ATACAGAAAAAGAGGTTGGATGG - Intronic
961257948 3:125572729-125572751 ATACAGAAAAAGAGGTTGGATGG - Intronic
961895365 3:130162949-130162971 CCTCATAAAATGAGTTAGGTAGG + Intergenic
962085534 3:132187641-132187663 ATTAATGAAAAGGGGTAGGGAGG + Intronic
962157193 3:132960353-132960375 CTTCATAAAATGAGTTAGGGAGG - Intergenic
962656293 3:137547267-137547289 ACTCATAAAATGAGTTAGGGAGG - Intergenic
962822807 3:139068438-139068460 CCTCATAAAAAGAGTTAGGGAGG - Intronic
962833845 3:139168978-139169000 CTTCATAAAATGAGTTAGGGAGG + Intronic
962983626 3:140513644-140513666 CCTCATAAAATGAGTTAGGTAGG + Intronic
963013616 3:140799768-140799790 ACTCATAAAATGAGTTAGGGAGG + Intergenic
963027786 3:140936974-140936996 AATCATAAAATGAGTTAGGGAGG - Intergenic
963377062 3:144480950-144480972 ATTCAAAAAGAGAGGTAGTGGGG - Intergenic
964184912 3:153930937-153930959 CCTCATAAAATGAGGTAGGGAGG + Intergenic
964270348 3:154948776-154948798 CCTCATAAAAAGAGTTAGGGAGG - Intergenic
964535975 3:157722074-157722096 ATTCATAGAATGAGTTAGGGAGG + Intergenic
964545771 3:157831489-157831511 ATTCAGGACAAGAGGAAGGTGGG - Intergenic
964962906 3:162450169-162450191 ACTCATAAAATGAGTTAGGGAGG + Intergenic
965073073 3:163940803-163940825 AGTGGTAATAAGAGGTAGGTAGG + Intergenic
965173943 3:165305741-165305763 ATTAATAACAAGAGGTACTTTGG + Intergenic
965195428 3:165588644-165588666 CTTCATAAAATGAGTTAGGGAGG - Intergenic
965304247 3:167044015-167044037 CCTCATAAAATGAGTTAGGTAGG + Intergenic
965652166 3:170946120-170946142 CTTCATAAAATGAGTTAGGGAGG + Intergenic
965706852 3:171517548-171517570 CTTCATAAAATGAGTTAGGGAGG + Intergenic
965992131 3:174831617-174831639 TCTCATAAAAAGAGTTAGGGAGG + Intronic
966133901 3:176676454-176676476 CTTCATAAAATGAGTTAGGGAGG - Intergenic
966519701 3:180859844-180859866 ATTCATAGAATGAGCTAGGGAGG - Intronic
966539304 3:181071854-181071876 CTTCATAAAATGAGTTAGGGAGG + Intergenic
967393408 3:188979742-188979764 ATTCATAATCAGAGGGAGGAGGG - Intronic
967451920 3:189634313-189634335 ATTCATAAATTAAGGTAGCTTGG - Intronic
967835475 3:193959058-193959080 TCTTATAAAAAGAGGAAGGTGGG + Intergenic
969187027 4:5483096-5483118 ACTCATAAAATGAGTTAGGGAGG + Intronic
970389260 4:15591088-15591110 ATTCATAAAAATATGCATGTTGG - Intronic
970470140 4:16369789-16369811 CTTCATAAAATGAGTTAGGGAGG + Intergenic
970494640 4:16612834-16612856 CTTCATAAAATGAGTTAGGGAGG - Intronic
970668672 4:18368927-18368949 CTTCATAGAATGAGTTAGGTAGG - Intergenic
970668749 4:18371108-18371130 CTTCATAGAATGAGTTAGGTAGG - Intergenic
971131312 4:23813977-23813999 ATTTATAAACATAGGTAGTTTGG + Exonic
971575905 4:28274257-28274279 CTTCATAAAATGAGTTAGGGAGG + Intergenic
971734214 4:30425335-30425357 CTTCATAAAATGAGTTAGGGAGG - Intergenic
971853382 4:32012352-32012374 CTTCATAAAATGAGATAGGGAGG - Intergenic
972140896 4:35957999-35958021 ATTCAAAATAAGATGTGGGTGGG - Intronic
972219644 4:36939246-36939268 ACTCATAAAATGAGTTAGGGAGG - Intergenic
972946967 4:44268025-44268047 CTTCATAAAATGAGTTAGGGAGG - Intronic
973604894 4:52576757-52576779 ATTCAGAACAAGATTTAGGTGGG + Intergenic
974162087 4:58153149-58153171 ACTCATAAAATGAGTTAGGGAGG - Intergenic
974246838 4:59331246-59331268 CTTCATAAAATGAGTTAGGGAGG - Intergenic
974371446 4:61021634-61021656 ACTCATAAAATGAGTTAGGGAGG - Intergenic
974394156 4:61313755-61313777 ATTAATAAAAAGAAGTACGGTGG + Intronic
974612787 4:64238285-64238307 CTTCATAAAATGAGTTAGGGAGG + Intergenic
974643640 4:64666215-64666237 CTTCATAAAATGAGTTAGGGAGG - Intergenic
974714999 4:65657654-65657676 ATTTATGAAAAGAGCTATGTTGG + Intronic
974723202 4:65768651-65768673 CTTCATAAAATGAGTTAGGGAGG + Intergenic
975075987 4:70209713-70209735 CTTCATAAAATGAGTTAGGGAGG + Intergenic
975453740 4:74564655-74564677 CTTCATAAAATGAGTTAGGGAGG - Intergenic
975887999 4:78988800-78988822 ATTCATAAGAAGGGGTAGAAAGG + Intergenic
976197261 4:82545028-82545050 CTTCATAAAATGAGTTAGGGAGG - Intronic
976357035 4:84130280-84130302 CCTCATAAAAAGAGTTAGGGAGG - Intergenic
976450786 4:85188542-85188564 ATTGATAAAAAGAGGAATTTTGG - Intergenic
976531002 4:86151699-86151721 GTCCATAAAAAGATGTAGGGAGG + Intronic
976535384 4:86208221-86208243 CTTCATAAAATGAGTTAGGGAGG - Intronic
976676949 4:87713869-87713891 CCTCATAAAAAGAGTTAGGGAGG - Intergenic
976684399 4:87796035-87796057 CCTCATAAAAAGAGTTAGGGAGG - Intergenic
976693161 4:87890365-87890387 CTTCATAAAATGAGTTAGGGAGG - Intergenic
976809585 4:89086617-89086639 CTTCATAAAATGAGTTAGGGAGG + Intronic
977264495 4:94838268-94838290 ACTCATAAAATGAGTTAGGGAGG + Intronic
977371474 4:96142518-96142540 ATTAGGAAAAAGAGGTTGGTGGG - Intergenic
977467400 4:97399812-97399834 CTTCATAAAATGAGTTAGGGAGG + Intronic
977747067 4:100561896-100561918 ATTCATAAAATGAGTTAGGAAGG - Intronic
977813591 4:101387199-101387221 CTTCATAAAATGAGTTAGGGAGG + Intergenic
978007596 4:103637070-103637092 ACTCATAAAATGAGTTAGGGAGG - Intronic
978274974 4:106938593-106938615 CCTCATAAAAAGAGTTAGGGAGG - Intronic
978283399 4:107044689-107044711 ACTCAGAAACAGAGGCAGGTAGG + Intronic
978336561 4:107675666-107675688 CTTCATAAAATGAGTTAGGGAGG - Intronic
978391781 4:108234906-108234928 ATTTATAAAGATAGCTAGGTTGG + Intergenic
978590941 4:110324330-110324352 CTTCATAAAATGAGTTAGGGAGG + Intergenic
978657177 4:111078186-111078208 ATTCATAAAATTAGTTAGGGAGG - Intergenic
979095911 4:116551120-116551142 CTTCATAAAATGAGTTAGGGAGG + Intergenic
979294891 4:119020728-119020750 ATTTATAAAAAAAATTAGGTAGG - Intronic
979501325 4:121443727-121443749 CTTCATAAAATGAGTTAGGGAGG - Intergenic
979583556 4:122388376-122388398 CTTCATAAAATGAGTTAGGGAGG + Intronic
979735375 4:124076231-124076253 CTTCATAAAATGAGTTAGGGAGG - Intergenic
980392602 4:132166405-132166427 CTTCATAAAATGAGTTAGGTAGG + Intergenic
980507814 4:133745634-133745656 GTTCATAAAATGAGTTAGGGAGG + Intergenic
980633598 4:135470447-135470469 CCTCATAAAATGAGTTAGGTAGG + Intergenic
980732871 4:136845271-136845293 CCTCATAAAAAGAGTTAGGGAGG + Intergenic
981345904 4:143676023-143676045 CTTCATAAAATGAGTTAGGGAGG - Intronic
981437328 4:144740653-144740675 ATTCATGATGAGAGGCAGGTAGG + Exonic
981609015 4:146572211-146572233 CCTCATAAAAAGAGTTAGGGAGG - Intergenic
981618442 4:146667108-146667130 CCTCATAAAAAGAGTTAGGGAGG - Intergenic
982059884 4:151594250-151594272 CTTCATAAAATGAGTTAGGGAGG + Intronic
982372631 4:154650479-154650501 TTTCATAAAATGAGTTAGGGAGG - Intronic
982853987 4:160357789-160357811 ATACATACAAATAGCTAGGTTGG + Intergenic
982871519 4:160584353-160584375 CTTCATAAAATGAGTTAGGGAGG - Intergenic
983113749 4:163785908-163785930 ATTCTCAAAAAGAGGAATGTAGG + Intronic
983307745 4:166014694-166014716 AATCATAAAATGAGGCAGGAGGG + Intronic
983364333 4:166766697-166766719 ACTCATAAAATGAGTTAGGGAGG + Intronic
983402090 4:167278643-167278665 CTTCATAAAATGAGTTAGGGAGG + Intergenic
983958486 4:173724453-173724475 CCTCATAAAAAGAGTTAGGGAGG + Intergenic
984480892 4:180300285-180300307 TTTTGTAAAAAGAGGTAGATTGG + Intergenic
984537068 4:180989726-180989748 ATTCACAAATATAGGTAGGTAGG + Intergenic
984827628 4:183941010-183941032 TTTCATAAAAAGTGGTCGGTTGG - Intronic
985193660 4:187404911-187404933 CTTCATAAAATGAGTTAGGGAGG + Intergenic
986114898 5:4763836-4763858 TTTCATAAAATGAGTTAGGGAGG - Intergenic
986754275 5:10820464-10820486 ATTCACAAAATGAGTTAGGGAGG + Intergenic
987352459 5:17033592-17033614 ATTCAAGAAAAGATTTAGGTGGG - Intergenic
987584241 5:19834027-19834049 CTTCATAAAATGAGTTAGGGAGG + Intronic
987704218 5:21442921-21442943 CTTCATAAAATGAGTTAGGGAGG + Intergenic
987909825 5:24126818-24126840 CTTCATAAAATGAGTTAGGGAGG + Intronic
988059819 5:26152141-26152163 CTTCATAAAATGAGTTAGGGAGG - Intergenic
988250530 5:28751368-28751390 ATTTATAAAAAGAGGTTTATTGG - Intergenic
988575897 5:32424245-32424267 ATTAAGAAAAAAAGGTAGGCTGG + Intronic
988871902 5:35399710-35399732 CCTCATAAAAAGAGTTAGGGAGG - Intergenic
989009188 5:36850919-36850941 ACTCATAAAATGAGTTAGGGAGG - Intergenic
989092393 5:37746900-37746922 CTTCATAAAATGAGTTAGGGAGG - Intronic
989320381 5:40127576-40127598 CTTCATAAAATGAGTTAGGGAGG + Intergenic
989324800 5:40179589-40179611 CTTCATAAAATGAGTTAGGGAGG - Intergenic
989618716 5:43363781-43363803 ATTCTGGAAAAGAGGTATGTAGG - Intergenic
989683910 5:44062399-44062421 CTTCATAAAATGAGTTAGGGAGG + Intergenic
989784956 5:45316047-45316069 CCTCATAAAATGAGTTAGGTAGG - Intronic
989828103 5:45883739-45883761 CTTCATAAAATGAGTTAGGGAGG + Intergenic
990838816 5:60052172-60052194 CTTCATAAAATGAGTTAGGGAGG - Intronic
990841165 5:60080888-60080910 CTTCATAAAATGAGTTAGGGAGG + Intronic
990899239 5:60732475-60732497 ACTCATAAAATGAGTTAGGGAGG - Intergenic
991110402 5:62893387-62893409 CTTCATAAAATGAGTTAGGAAGG + Intergenic
991639422 5:68738489-68738511 AATAATAAAATGAGGTGGGTGGG + Intergenic
991913016 5:71580183-71580205 ATTTAAAAAAAGATGTAGGCCGG - Intergenic
992650055 5:78850568-78850590 ACTCATAAAATGAGTTAGGGAGG + Intronic
992652158 5:78870296-78870318 ACTCATAAAATGAGTTAGGGAGG - Intronic
992659204 5:78941791-78941813 ACTCATAAAATGAGTTAGGGAGG + Intronic
992898157 5:81265327-81265349 ATGCATATAAAGAGATAGATAGG + Intronic
992908019 5:81366615-81366637 ATTCATAAAAACAGGTCTATAGG + Intronic
992958390 5:81933869-81933891 CCTCATAAAATGAGGTAGGGAGG - Intergenic
993288074 5:86027005-86027027 ATTCAAAATAAGAGGTATCTGGG + Intergenic
993317889 5:86434545-86434567 CTTCATAAAATGAGTTAGGGAGG + Intergenic
993628644 5:90257062-90257084 ATTAAAATAAACAGGTAGGTGGG + Intergenic
993808230 5:92439444-92439466 CTTCATAAAATGAGTTAGGGAGG - Intergenic
993819153 5:92592285-92592307 ATTAAGAAAAAGAGGTATGAAGG + Intergenic
994344847 5:98672252-98672274 CTTCATAAAATGAGTTAGGGAGG - Intergenic
994560308 5:101361701-101361723 ATATATAAAAAGAGGTAATTTGG - Intergenic
995003344 5:107161412-107161434 CTTCATAAAATGAGTTAGGGAGG - Intergenic
995081067 5:108051218-108051240 CTTCATAAAATGAGTTAGGGAGG - Intronic
995117135 5:108494038-108494060 CTTCATAAAATGAGTTAGGGAGG - Intergenic
995153151 5:108875391-108875413 ATGCAAAAAAAGAGGCAGATGGG - Intronic
995168412 5:109076086-109076108 ATTAATATAAAAATGTAGGTGGG - Intronic
995263495 5:110132934-110132956 CCTCATAAAAAGAGTTAGGGAGG + Intergenic
995361788 5:111305729-111305751 CTTCATAAAATGAGTTAGGGAGG - Intronic
995628314 5:114103934-114103956 CCTCATAAAAAGAGTTAGGGAGG + Intergenic
995685014 5:114763118-114763140 CTTCATAAAATGAGTTAGGGAGG + Intergenic
995715093 5:115074630-115074652 CCTCATAAAATGAGGTAGGGAGG - Intergenic
995986791 5:118186403-118186425 ATTCATAATAAGATTTGGGTGGG - Intergenic
996197048 5:120621534-120621556 ATTCATGAAGAGATTTAGGTTGG - Intronic
996894167 5:128459434-128459456 CTTCATAAAATGAGTTAGGGAGG - Intronic
996964108 5:129287738-129287760 CTTCATAAAATGAGTTAGGGAGG + Intergenic
997876277 5:137550562-137550584 CTTCATAAAATGAGTTAGGGAGG - Intronic
998719742 5:144931173-144931195 CTTCATAAAATGAGTTAGGGAGG + Intergenic
998755310 5:145371620-145371642 CTTCATAAAATGAGTTAGGGAGG + Intergenic
999548354 5:152656476-152656498 CCTCATAAAAAGAGTTAGGGAGG + Intergenic
999575206 5:152968762-152968784 ATTCATAGAATGAGTTAGGGAGG - Intergenic
1000109633 5:158095430-158095452 ATTGATAAAATGAGTTAGTTTGG + Intergenic
1000375805 5:160580667-160580689 CTTCATAAAATGAGTTAGGGAGG + Intronic
1000383685 5:160652190-160652212 TTTCATGAAAAGAGGAAGATGGG - Intronic
1000584207 5:163076400-163076422 CTTCATAAAATGAGTTAGGGAGG + Intergenic
1000589839 5:163145060-163145082 AATAATGAAAAGAGGTATGTTGG + Intergenic
1000590345 5:163150369-163150391 CCTCATAAAAAGAGTTAGGGAGG - Intergenic
1001839380 5:174861450-174861472 CTTCATAAAATGAGTTAGGGAGG + Intergenic
1002615122 5:180448182-180448204 CCTCATAAAAAGAGTTAGGGAGG + Intergenic
1003249083 6:4409369-4409391 TTTCATAAAATGAGTTAGGGAGG - Intergenic
1003803136 6:9694188-9694210 GTTCATAAAATGAGTTAGGGAGG - Intronic
1003888804 6:10545083-10545105 ATTCTTAAAAAGAGGAATGATGG - Intronic
1003987882 6:11455446-11455468 CCTCATAAAATGAGTTAGGTAGG - Intergenic
1004103105 6:12635405-12635427 TTTCATAAAATGAGTTAGGGAGG + Intergenic
1004890137 6:20093136-20093158 ATTCATAAAAAGAAGCTGCTTGG + Intergenic
1005038833 6:21583217-21583239 ATTCATAAAATGATTTAGGGAGG + Intergenic
1005102511 6:22187674-22187696 GTTCATTAAAACAGGTATGTTGG - Intergenic
1005171474 6:22990305-22990327 CCTCATAAAATGAGCTAGGTAGG + Intergenic
1005336998 6:24807310-24807332 ATACAAAAAAAGAGTTAGCTGGG + Intronic
1005586124 6:27278182-27278204 ATTGGTAAATAGAGGCAGGTAGG + Intergenic
1005770134 6:29061133-29061155 CTTCATAAAATGAGTTAGGGAGG + Intergenic
1006252823 6:32804162-32804184 CTTCATAGAATGAGTTAGGTAGG + Intergenic
1007012128 6:38428018-38428040 TTGCATAAAAAGAGGTAAGCAGG + Intronic
1007840160 6:44709511-44709533 ATTTATAAAAACAGGTGGGCTGG - Intergenic
1008461893 6:51785136-51785158 ATTCAATGAAAGAGGGAGGTGGG + Intronic
1009493059 6:64315699-64315721 CCTCATAAAATGAGGTAGGGAGG - Intronic
1009517241 6:64635832-64635854 CTTCATAAAATGAGTTAGGGAGG + Intronic
1009570605 6:65379098-65379120 ACTCATAAAATGAGTTAGGGAGG - Intronic
1009909394 6:69906450-69906472 ATTAAAAAAAAGAGGGAGGGAGG + Intronic
1010334388 6:74663626-74663648 CCTCATAAAATGAGGTAGGGAGG - Intergenic
1010503155 6:76625648-76625670 CTTCATAAAATGAGTTAGGGAGG + Intergenic
1010576500 6:77538468-77538490 CTTCATAAAATGAGTTAGGGAGG - Intergenic
1010593074 6:77733136-77733158 CTTCATAAAATGAGTTAGGGAGG + Intronic
1010724895 6:79322156-79322178 CTTCATAAAATGAGTTAGGGAGG + Intergenic
1010834526 6:80570428-80570450 CTTCATAAAATGAGTTAGGGAGG + Intergenic
1010868945 6:81014576-81014598 CTTCATAAAATGAGTTAGGGAGG + Intergenic
1011006274 6:82648971-82648993 CTTCATAAAATGAGTTAGGGAGG - Intergenic
1011073021 6:83406338-83406360 CTTCATAAAATGAGTTAGGGAGG + Intronic
1011321430 6:86097861-86097883 CTTCATAAAATGAGTTAGGGAGG - Intergenic
1011336678 6:86269044-86269066 CCTCATAAAATGAGTTAGGTAGG + Intergenic
1011337826 6:86280652-86280674 CCTCATAAAATGAGTTAGGTAGG + Intergenic
1011358220 6:86494619-86494641 CCTCATAAAATGAGGTAGGGAGG + Intergenic
1011376410 6:86691890-86691912 CCTCATAAAATGAGGTAGGGAGG + Intergenic
1011393763 6:86883434-86883456 CCTCATAAAATGAGGTAGGGAGG + Intergenic
1011578552 6:88831070-88831092 CCTCATAAAATGAGTTAGGTTGG - Intronic
1011803928 6:91049656-91049678 CTTCATAAAATGAGTTAGGGAGG + Intergenic
1011815795 6:91188725-91188747 ACTCATAAAAAGAGTTAGGGAGG + Intergenic
1011876968 6:91973711-91973733 CTTCATAAAATGAGTTAGGGAGG - Intergenic
1012020499 6:93912411-93912433 ACTCATAAAAAGTGGTAGACTGG - Intergenic
1012148844 6:95720212-95720234 CCTCATAAAATGAGTTAGGTAGG - Intergenic
1012220336 6:96641275-96641297 CTTCATAAAATGAGTTAGGGAGG - Intergenic
1012392957 6:98763773-98763795 CTTCATAAAATGAGTTAGGGAGG - Intergenic
1012922115 6:105231054-105231076 CTTCATAAAATGAGTTAGGGAGG + Intergenic
1013423500 6:109988550-109988572 CTTCATAAAATGAGTTAGGGAGG + Intergenic
1013461889 6:110382419-110382441 CTTCATAAAATGAGTTAGGGAGG - Intergenic
1014013606 6:116504514-116504536 CTTCATAAAATGAGTTAGGGAGG - Intronic
1014085129 6:117333476-117333498 CTTCATAAAATGAGTTAGGAAGG - Intronic
1014097923 6:117480792-117480814 ATTCATAATGTGAGGCAGGTGGG - Intronic
1014120998 6:117724912-117724934 CTTCATAAAATGAGTTAGGGAGG - Intergenic
1014185566 6:118430427-118430449 CTTCATAAAATGAGTTAGGGAGG - Intergenic
1015358518 6:132308502-132308524 CTTCATAAAATGAGTTAGGGAGG - Intronic
1015986432 6:138888608-138888630 ATTAAGAAAAAGAAGTAGGCTGG - Intronic
1016232130 6:141818311-141818333 CCTCATAAAAAGAGTTAGGGAGG - Intergenic
1016487019 6:144552318-144552340 ATTCATAAAAAGAGAAAAGAAGG - Intronic
1016586624 6:145695152-145695174 AATCATAAAATGTGGTAGGGAGG + Intronic
1016887789 6:148974176-148974198 ATTATTAAAAGGAGGTGGGTAGG + Intronic
1017060959 6:150484653-150484675 ATGCAGAATAACAGGTAGGTAGG - Intergenic
1017279951 6:152612631-152612653 ACTCATAAAATGAGTTAGGGGGG - Intronic
1017390796 6:153937238-153937260 CTTCATAAAATGAGTTAGGGAGG + Intergenic
1017414975 6:154210298-154210320 AATCATAAAAAGAGGTATATTGG + Intronic
1017563946 6:155664106-155664128 AAACATCAGAAGAGGTAGGTGGG + Intergenic
1017688207 6:156934823-156934845 GTTCATAAAAACAGGGAGGGAGG - Intronic
1017959921 6:159212811-159212833 ATTCATTAGAAGAGGTTGGGAGG + Intronic
1018011455 6:159674228-159674250 CTTCATAAAATGAGTTAGGGAGG - Exonic
1018075730 6:160211227-160211249 ACTCATAAAATGAGTTAGGGAGG + Intronic
1018376065 6:163214056-163214078 ATTAATGAAAAGAGTTTGGTTGG - Intronic
1018496756 6:164355404-164355426 CTTCATAGAAAGAGTTAGGGAGG + Intergenic
1019113197 6:169734797-169734819 CTTCATAAAATGAGTTAGGGAGG + Intergenic
1020428957 7:8099756-8099778 CTTCATAAAATGAGTTAGGGAGG - Intergenic
1020519253 7:9165879-9165901 CTTCATAAAATGAGTTAGGGAGG + Intergenic
1020633466 7:10668971-10668993 CTTCATAAAATGAGTTAGGGAGG + Intergenic
1020693508 7:11388203-11388225 CCTCATAAAATGAGGTAGGGAGG + Intronic
1020768711 7:12359082-12359104 TTTCATAAATAGAGCTATGTTGG - Intronic
1021015002 7:15521329-15521351 CCTCATAAAAAGAGTTAGGGAGG - Intronic
1021028979 7:15705707-15705729 ATTCATAAATTGAGGGAGGGAGG + Intergenic
1021051285 7:15988423-15988445 TTTCATAAAAATAGGGAGATGGG - Intergenic
1021747451 7:23756999-23757021 CTTCATAAAATGAGTTAGGGAGG + Intronic
1021750303 7:23792687-23792709 AGTCATAAAATCAGGTAGTTTGG - Intronic
1022039212 7:26564031-26564053 CTTCATAAAATGAGTTAGGGAGG + Intergenic
1022435096 7:30375557-30375579 ATTTATAAAAACAGGTACTTTGG - Intronic
1022619417 7:31967592-31967614 CCTCATAAAAAGAGTTAGGGAGG - Intronic
1023717904 7:43062593-43062615 CCTCATAAAAAGAGTTAGGGAGG - Intergenic
1024577788 7:50778848-50778870 ATTCTTAAAAGAAGGCAGGTGGG + Intronic
1024956125 7:54923140-54923162 CTTCATAAAATGAGTTAGGGAGG - Intergenic
1025017836 7:55454431-55454453 CTTCATAAAATGAGTTAGGGAGG - Intronic
1025200551 7:56958800-56958822 AAACAAAAAAAGAGGTAGATGGG + Intergenic
1025521001 7:61729846-61729868 CTTCATAAAATGAGTTAGGGAGG - Intergenic
1025545354 7:62159407-62159429 CTTCATAAAATGAGTTAGGGAGG - Intergenic
1025671393 7:63618132-63618154 AAACAAAAAAAGAGGTAGATGGG - Intergenic
1026643225 7:72145603-72145625 CTTCATAAAATGAGTTAGGGAGG - Intronic
1027574812 7:79918688-79918710 CTTCATAAAATGAGTTAGGGAGG - Intergenic
1027639578 7:80716604-80716626 CCTCATAAAAAGAGTTAGGGAGG - Intergenic
1027786232 7:82582159-82582181 CTTCATAAAATGAGTTAGGGAGG + Intergenic
1027792606 7:82652464-82652486 CCTCATAAAATGAGTTAGGTAGG - Intergenic
1027864235 7:83626215-83626237 CCTCATAAAAAGAGTTAGGGAGG + Intronic
1028049206 7:86161009-86161031 CTTCATAAAATGAGTTAGGGAGG - Intergenic
1028082036 7:86589427-86589449 ACTCATAAAATGAGTTAGGGAGG - Intergenic
1028346625 7:89791498-89791520 CCTCATAAAAAGAGTTAGGGAGG + Intergenic
1028442851 7:90883570-90883592 CTTCATAAAATGAGTTAGGAAGG - Intronic
1028533849 7:91869095-91869117 TTTCATAATAAAAGGTAGGAAGG + Intronic
1028577912 7:92372759-92372781 GTTCATAAATGTAGGTAGGTAGG - Intronic
1028626503 7:92883336-92883358 ATTAATAAAAAGAGGAACTTTGG + Intergenic
1028685894 7:93588252-93588274 CCTCATAAAAAGAGTTAGGGAGG + Intergenic
1029017935 7:97333684-97333706 CCTCATAAAATGAGGTAGGGAGG - Intergenic
1029879086 7:103787816-103787838 CCTCATAAAAAGAGTTAGGGAGG - Intronic
1030244910 7:107372758-107372780 ATTCTTAAAAAAAGGTGGGGTGG + Exonic
1030398062 7:109013200-109013222 CCTCATAAAAAGAGTTAGGGAGG - Intergenic
1030475856 7:110032642-110032664 CCTCATAAAAAGAGTTAGGGAGG + Intergenic
1030514741 7:110525613-110525635 ATTCATAAGAACAGGTACCTGGG + Intergenic
1031469982 7:122157308-122157330 AATCATGAAAAGAGGAAGGTGGG + Intergenic
1031548663 7:123081837-123081859 ACTCATAAAATGAGTTAGGGAGG + Intergenic
1031811255 7:126372089-126372111 CTTCATAGAACGAGGTAGGAAGG - Intergenic
1032015406 7:128377019-128377041 AGTGCTAAAAAGAGGTAGGGTGG - Intergenic
1032826745 7:135577558-135577580 TTTCATAAAAAGAGCTAGAATGG - Intronic
1032920262 7:136537503-136537525 ACTCATAAAATGAGTTAGGGAGG - Intergenic
1033067145 7:138167077-138167099 ATTCAAAAAAAGAATTAGCTAGG - Intergenic
1033724461 7:144099102-144099124 ATTAAAAAAAAGAGGGAGGGAGG - Intergenic
1033927304 7:146479153-146479175 ATTCAAAACTAAAGGTAGGTAGG - Intronic
1034375231 7:150637173-150637195 ACTCATAAAATGAGTTAGGAAGG + Intergenic
1034583029 7:152062974-152062996 CTTCATAAAATGAGTTAGGGAGG + Intronic
1035492015 7:159288085-159288107 CTTCATAAAATGAGTTAGGGAGG - Intergenic
1036370464 8:8158326-8158348 CCTCATAAAATGAGTTAGGTAGG - Intergenic
1036880428 8:12507305-12507327 CCTCATAAAATGAGTTAGGTAGG + Intergenic
1037691190 8:21183063-21183085 ATTCATAAAAAGAGACTGGATGG + Intergenic
1037996106 8:23353368-23353390 TTTCTTAAAAGGAGGTAAGTAGG - Intronic
1038461521 8:27721113-27721135 ACTCATGAAATGAGGGAGGTGGG - Intergenic
1038750343 8:30289017-30289039 GTTCATTAAAATAGGTAGGTAGG + Intergenic
1039158468 8:34589919-34589941 CTTCATAAAATGAGTTAGGGAGG - Intergenic
1039170704 8:34741668-34741690 CCTCATAAAATGAGGTAGGAAGG - Intergenic
1039225710 8:35385763-35385785 TCTGTTAAAAAGAGGTAGGTAGG - Intronic
1039293514 8:36124425-36124447 CTTCATAAAATGAGTTAGGGAGG + Intergenic
1039330570 8:36532620-36532642 ATTCAAAAACATAGGTAGGGTGG - Intergenic
1039397478 8:37238993-37239015 ATTGAAATAGAGAGGTAGGTTGG + Intergenic
1039402579 8:37282858-37282880 CTTCATAAAATGAGTTAGGAAGG - Intergenic
1040354425 8:46603287-46603309 CTTCATAAAATGAGTTAGGGAGG + Intergenic
1040373583 8:46800941-46800963 CCTCATAAAATGAGTTAGGTAGG - Intergenic
1040376781 8:46833472-46833494 CCTCATAAAATGAGTTAGGTAGG - Intergenic
1040411109 8:47155354-47155376 CTTCATAAAACGAGTTAGGGAGG - Intergenic
1040519761 8:48165873-48165895 CTTCATAAAATGAGTTAGGGAGG + Intergenic
1040613870 8:49015007-49015029 CTTCATAAAACGAGTTAGGGAGG + Intergenic
1040617447 8:49051702-49051724 TTTCATAGAATGAGGTAGGGAGG + Intergenic
1040968482 8:53108990-53109012 CATCATAAAATGAGTTAGGTAGG + Intergenic
1041255220 8:55974417-55974439 ATTGGTAAAATGAGGAAGGTAGG + Intronic
1041736612 8:61117881-61117903 CTTCATAAAATGAGTTAGGGAGG + Intronic
1041771495 8:61477308-61477330 CTTCATAAAATGAGTTAGGGAGG + Intronic
1042111270 8:65383577-65383599 TCTCATAAAATGAGGTAGGGAGG - Intergenic
1042444066 8:68863061-68863083 ATTCTTCAAAAGAGTTAGGGAGG - Intergenic
1042627913 8:70779463-70779485 CCTCATAAAATGAGGTAGGGAGG + Intronic
1042763379 8:72294752-72294774 TTTCATAAAATGAGTTAGGGAGG - Intergenic
1043071363 8:75640105-75640127 CTTCATAAAAAGACTTAGGGAGG + Intergenic
1043223533 8:77696207-77696229 CTTCATAAAATGAGTTAGGAAGG + Intergenic
1043244109 8:77976249-77976271 CTTCATAAAATGAGTTAGGGAGG + Intergenic
1043279184 8:78441255-78441277 CTTAATAAAAGGAGGAAGGTGGG - Intergenic
1043586117 8:81771709-81771731 CCTCATAAAAAGAGTTAGGGAGG - Intergenic
1043786318 8:84404681-84404703 CCTCATAAAAAGAGTTAGGGAGG + Intronic
1043888963 8:85635028-85635050 ATTGATGAAAAGAGCAAGGTGGG + Intergenic
1044448878 8:92310867-92310889 CTTCATAAAATGAGTTAGGGAGG + Intergenic
1044816658 8:96120166-96120188 CCTCATAAAAAGAGTTAGGGAGG - Intergenic
1045146903 8:99355619-99355641 ATTCATTTAGAGAGGTAGGTAGG - Intronic
1045531048 8:102985761-102985783 AATAATAAAAAGAAGTAGATTGG + Intergenic
1045591690 8:103605509-103605531 CCTCATAAAAAGAGTTAGGGAGG + Intronic
1045606731 8:103785779-103785801 CCTCATAAAAAGAGTTAGGGAGG + Intronic
1045705130 8:104913706-104913728 CTTCATAAAATGAGTTAGGGAGG + Intronic
1046594340 8:116243161-116243183 ATTTATAAAAATAGGTGGGAAGG - Intergenic
1046610112 8:116413942-116413964 CTTCATAAAATGAGTTAGGGAGG - Intergenic
1046881209 8:119310402-119310424 CTTCATAAAATGAGTTAGGGAGG - Intergenic
1047021664 8:120781657-120781679 ATTCATAAAAAGAGGTAGGTTGG - Intronic
1047393116 8:124470500-124470522 CTTCATAAAAAGAGGAAGAAAGG + Intergenic
1047801456 8:128314718-128314740 ATTAAGAAAAATATGTAGGTTGG + Intergenic
1049997534 9:1046411-1046433 ATTCGTAAAAAGAACTGGGTGGG + Intergenic
1050141233 9:2518108-2518130 GTTCATAAAATGAGCTAGGGAGG + Intergenic
1050200873 9:3144428-3144450 CCTCATAAAATGAGGTAGGCAGG + Intergenic
1050263623 9:3867183-3867205 GTTCATAAAAGTAGATAGGTCGG + Intronic
1050404813 9:5296654-5296676 CTTCATAAAATGAGTTAGGGAGG - Intergenic
1050501150 9:6298978-6299000 CTTCATAAAATGAGTTAGGGAGG - Intergenic
1050638994 9:7645386-7645408 ATTCATAGAATGAGTTAGGGAGG + Intergenic
1050773236 9:9230248-9230270 ATTCTAAAGAGGAGGTAGGTAGG + Intronic
1050783654 9:9371122-9371144 CTTCATAAAATGAGTTAGGGAGG + Intronic
1050834794 9:10062879-10062901 ATTCATTAACAGAGGTAAATTGG - Intronic
1050884839 9:10751196-10751218 CCTCATAAAATGAGGTAGGGAGG - Intergenic
1051035806 9:12743774-12743796 CTTCATAAAATGAGTTAGGGAGG + Intergenic
1051161720 9:14216119-14216141 CTTCATAACAAAAGATAGGTTGG + Intronic
1051373535 9:16380262-16380284 CTTCATAAAATGAGTTAGGGAGG + Intergenic
1051479755 9:17546609-17546631 CTTCATAAAATGAGTTAGGGAGG - Intergenic
1051569277 9:18537497-18537519 AATCAAAACCAGAGGTAGGTGGG + Intronic
1051835851 9:21336693-21336715 ATTCAACACAAGAGGTTGGTTGG + Intergenic
1051856238 9:21569301-21569323 ATTCATAAAATGAGCTATGATGG + Intergenic
1052241715 9:26281038-26281060 CTTCATAAAATGAGTTAGGGAGG - Intergenic
1052386946 9:27833933-27833955 CTTCATAAAATGAGTTAGGGAGG + Intergenic
1052546989 9:29892236-29892258 CTTCATAAAATGAGTTAGGGAGG - Intergenic
1052596724 9:30570938-30570960 CTTCATAAAATGAGTTAGGGAGG - Intergenic
1052644174 9:31211144-31211166 ACTCATAAAAAGAGGAATTTTGG + Intergenic
1052710015 9:32042601-32042623 ATTCAGAATAGGAGGTGGGTGGG - Intergenic
1053027850 9:34745472-34745494 ATTTACAATAAGAGGTAGGTAGG + Intergenic
1053591232 9:39516632-39516654 GTTCATAAAAAGAAGCAAGTAGG - Intergenic
1053628054 9:39897140-39897162 CCTCATAAAAAGAGTTAGGGAGG - Intergenic
1054215833 9:62353561-62353583 CCTCATAAAAAGAGTTAGGGAGG + Intergenic
1054575076 9:66848661-66848683 GTTCATAAAAAGAAGCAAGTAGG + Intergenic
1054671649 9:67801789-67801811 CCTCATAAAAAGAGTTAGGGAGG - Intergenic
1055548942 9:77412226-77412248 CTTCATAAAATGAGTTAGGGAGG - Intronic
1055873630 9:80916454-80916476 CCTCATAAAATGAGCTAGGTAGG - Intergenic
1056439704 9:86608543-86608565 CCTCATAAAAAGAGTTAGGGAGG + Intergenic
1056909935 9:90689895-90689917 CTTCATAAAATGAGTTAGGGAGG - Intergenic
1056993107 9:91428895-91428917 ATTAACAAAAAAAGGTGGGTAGG + Intergenic
1057109380 9:92452608-92452630 CCTCATAAAAAGAGTTAGGGAGG + Intronic
1057121617 9:92580311-92580333 CCTCATAAAAAGAGTTAGGGAGG + Intronic
1058029607 9:100180761-100180783 CCTCATAAAATGAGGTAGGGAGG - Intronic
1058064195 9:100530718-100530740 CCTCATAAAAAGAGTTAGGAAGG - Intronic
1058137524 9:101323537-101323559 TTTAATAAAAAGAGGTAAGGAGG + Intronic
1058182894 9:101819463-101819485 CTTCATAAAATGAGTTAGGGAGG - Intergenic
1058354759 9:104071204-104071226 AATGACAAAAAGAGGGAGGTAGG + Intergenic
1058374693 9:104308892-104308914 CTTCATAAAAAGAGTTAGGGAGG - Intergenic
1058738655 9:107920700-107920722 ATTAAAGAAAAGAAGTAGGTGGG - Intergenic
1059542039 9:115140446-115140468 ATTCACAAAAATAAGTAGATGGG + Intergenic
1059602878 9:115800419-115800441 ATTCATATAAAGATGTACCTTGG + Intergenic
1059736650 9:117106498-117106520 ATTAATAAAAATATGTAGCTTGG - Intronic
1059745890 9:117200871-117200893 CTTCATAAAATGAGTTAGGAAGG + Intronic
1059864357 9:118497991-118498013 ACTCATAAAATGAGTTAGGGAGG + Intergenic
1060026899 9:120180585-120180607 CTTCATAAAATGAGTTAGGGAGG - Intergenic
1203382765 Un_KI270435v1:75128-75150 CTTCATAAAATGAGTTAGGGAGG + Intergenic
1203402385 Un_KI270519v1:122692-122714 CTTCATAAAATGAGTTAGGGAGG + Intergenic
1203533903 Un_KI270743v1:12658-12680 ACTCATAAAATGAGTTAGGGAGG - Intergenic
1186177097 X:6936116-6936138 CCTCATAAAAAGAGTTAGGGAGG - Intergenic
1186375198 X:8991177-8991199 ACTGATAAAAAGAGGTGGATAGG - Intergenic
1186431275 X:9506914-9506936 CTTCATAAAATGAGTTAGGGAGG - Intronic
1186619095 X:11218471-11218493 ACTCATAAAATGAGTTAGGGAGG + Intronic
1186821270 X:13290617-13290639 ATTTAGAAAAAGAGCAAGGTGGG + Intergenic
1186836168 X:13440715-13440737 AATCTTAAAAAGTGGTAAGTGGG - Intergenic
1186866762 X:13728232-13728254 CTTCATAAAATGAGTTAGGGAGG - Intronic
1186919669 X:14264231-14264253 CTTCATAAAATGAGTTAGGGAGG + Intergenic
1186926095 X:14335092-14335114 ATTCAAAATAAGATTTAGGTGGG + Intergenic
1188092490 X:25980362-25980384 CTTCATAAAATGAGTTAGGGAGG - Intergenic
1188123420 X:26337608-26337630 CTTCATAAAATGAGTTAGGGAGG - Intergenic
1188560897 X:31467674-31467696 CCTCATAAAAAGAGTTAGGGAGG + Intronic
1188785729 X:34344081-34344103 CTTCATAAAATGAGTTAGGGAGG - Intergenic
1189039428 X:37526975-37526997 CTTCATAAAATGAGTTAGGGAGG + Intronic
1189553259 X:42114790-42114812 ATTCAAAATAAGATTTAGGTGGG + Intergenic
1189877366 X:45450049-45450071 ATTCAAAGAATGTGGTAGGTTGG - Intergenic
1190463843 X:50706139-50706161 AATGATAAAAGGAGGTATGTAGG - Intronic
1190494449 X:51015164-51015186 CTTCATAAAATGAGTTAGGGAGG + Intergenic
1190530010 X:51365260-51365282 CTTCATAAAATGAGTTAGGGAGG - Intergenic
1190548286 X:51552880-51552902 CTTCATAAAATGAGTTAGGGAGG + Intergenic
1190550894 X:51579283-51579305 CTTCATAAAATGAGTTAGGGAGG - Intergenic
1190636307 X:52437423-52437445 AATCATAAACAGAGGGAGGCTGG + Intergenic
1190683102 X:52845990-52846012 ACTCATAAAATGAGTTAGGGAGG + Intergenic
1190792887 X:53716367-53716389 ATTCATACATGGAGGTAGGCGGG + Intergenic
1190800808 X:53786968-53786990 ACTCATAAAATGAGTTAGGGAGG - Intergenic
1191071663 X:56407226-56407248 CTTCATAAAATGAGTTAGGGAGG + Intergenic
1191082153 X:56523872-56523894 CTTCATAAAATGAGTTAGGGAGG + Intergenic
1191091863 X:56632083-56632105 CCTCATAAAAAGAGTTAGGGAGG + Intergenic
1191092629 X:56639633-56639655 ACTCATAAAATGAGTTAGGGAGG - Intergenic
1191168229 X:57414725-57414747 ACTCATAAAATGAGTTAGGGCGG + Intronic
1191207041 X:57845711-57845733 CTTCATAAAATGAGTTAGGGAGG - Intergenic
1191597622 X:62963194-62963216 CTTCATAAAATGAGTTAGGGAGG + Intergenic
1191644235 X:63462822-63462844 CTTCATAAAATGAGTTAGGGAGG + Intergenic
1191645535 X:63477202-63477224 ATTCATAGAAAGAGCTAAGGAGG - Intergenic
1191676972 X:63801376-63801398 TCTCATAAAATGAGTTAGGTAGG - Intergenic
1191768529 X:64729780-64729802 CCTCATAAAAAGAGTTAGGGAGG + Intergenic
1191772143 X:64772535-64772557 CTTCATAAAATGAGTTAGGGAGG + Intergenic
1191824501 X:65349989-65350011 CTTCATAAAATGAGTTAGGGAGG - Intergenic
1191906309 X:66094484-66094506 CTTCATAAAATGAGTTAGGGAGG - Intergenic
1192063897 X:67860926-67860948 CTTCATAAAATGAGTTAGGGAGG + Intergenic
1192097521 X:68228390-68228412 CTTCATAAAATGAGTTAGGGAGG - Intronic
1192267739 X:69551263-69551285 ATACATAAAAAAAGGTTGGATGG + Intergenic
1192702040 X:73484746-73484768 CTTCATAAAATGAGTTAGGAAGG - Intergenic
1192753517 X:74020163-74020185 AATGATAAAAAGAGGCAAGTTGG + Intergenic
1192881442 X:75288308-75288330 ATTCATAGAATGAGTTAGGTAGG - Intronic
1193007401 X:76635773-76635795 CCTCATAAAATGAGGTAGGGAGG + Intergenic
1193064786 X:77247764-77247786 CCTCATAAAATGAGGTAGGGAGG - Intergenic
1193091474 X:77498194-77498216 CTTCATAAAATGAGTTAGGGAGG - Intergenic
1193181958 X:78468735-78468757 CTTCATAAAATGAGTTAGGGAGG + Intergenic
1193249832 X:79277840-79277862 CTTCATAAAATGAGTTAGGGAGG - Intergenic
1193255056 X:79338646-79338668 ATTCCTGAAAAGAGTTAGATGGG - Intergenic
1193261135 X:79407443-79407465 ACTCATAAAATGAGTTAGGGAGG - Intergenic
1193282200 X:79666325-79666347 CTTCATAGAATGAGGTAGGGAGG - Intergenic
1193327949 X:80204239-80204261 ATTCATATAATGAGTTAGGAAGG + Intergenic
1193504576 X:82326351-82326373 ATTCATAAAATGAGTTAGGGAGG - Intergenic
1193522571 X:82549054-82549076 CTTCATAAAATGAGTTAGGGAGG + Intergenic
1193547896 X:82852145-82852167 ACTCATAAAATGAGTTAGGGAGG + Intergenic
1193550182 X:82882722-82882744 CTTCATAGAATGAGTTAGGTAGG - Intergenic
1193719151 X:84967885-84967907 CTTCATAAAATGAGTTAGGGAGG + Intergenic
1193782113 X:85716171-85716193 CCTCATAAAAAGAGTTAGGGAGG + Intergenic
1194005728 X:88489116-88489138 CTTCATAAAACGAGTTAGGGAGG + Intergenic
1194231841 X:91334061-91334083 CCTCATAAAATGAGTTAGGTAGG + Intergenic
1194485685 X:94483066-94483088 CTTCATAAAATGAGTTAGGGAGG + Intergenic
1194570184 X:95546399-95546421 CTTCATAAAATGAGTTAGGGAGG + Intergenic
1194597045 X:95871250-95871272 CTTCATAAAATGAGTTAGGGAGG - Intergenic
1194628719 X:96256714-96256736 CTTCATAAAATGAGTTAGGGAGG + Intergenic
1194847994 X:98835821-98835843 ACTCATAAAATGAGTTAGGGAGG + Intergenic
1194852293 X:98884411-98884433 CTTCATAAAATGAGTTAGGGAGG - Intergenic
1194898285 X:99472400-99472422 CTTCATAGAATGAGTTAGGTAGG - Intergenic
1195084914 X:101404939-101404961 ATTCATTAAAAGATGAAGGCTGG + Intronic
1195395465 X:104405748-104405770 CTTCATAAAATGAGTTAGGGAGG + Intergenic
1195457153 X:105081984-105082006 CTTCATAAAATGAGTTAGGGAGG + Intronic
1195501704 X:105609261-105609283 ATTCATTAAAAGAGGTATTTGGG + Intronic
1195685943 X:107585951-107585973 CTTCATAAAATGAGTTAGGGAGG + Intronic
1195833431 X:109085833-109085855 ACTCATAAAATGAGTTAGGGGGG + Intergenic
1195840951 X:109176409-109176431 CTTCATAAAATGAGTTAGGGAGG - Intergenic
1196054807 X:111343566-111343588 CTTCATGAAATGAGGTAGGGAGG - Intronic
1196500926 X:116381015-116381037 ATTGATCAAAAGAGGAAGGCAGG - Intergenic
1196537581 X:116865804-116865826 CCTCATAAAATGAGTTAGGTAGG + Intergenic
1196546240 X:116967325-116967347 CCTCATAAAAAGAGTTAGGGAGG + Intergenic
1196570817 X:117264292-117264314 CTTCATAAAATGAGTTAGGGAGG - Intergenic
1196967505 X:121074003-121074025 ATTAATAAAAAGAGGAATTTTGG - Intergenic
1197029770 X:121799648-121799670 CTTCATAAAATGAGTTAGGGAGG + Intergenic
1197046102 X:122000543-122000565 CTTCATAAAATGAGTTAGGGAGG + Intergenic
1197510670 X:127365720-127365742 CTTCATAAAATGAGTTAGGGAGG - Intergenic
1197563804 X:128056033-128056055 AGTCATAGAAAGAGGTAGCTGGG + Intergenic
1197676970 X:129340540-129340562 CCTCATAAAAAGAGTTAGGGAGG - Intergenic
1198185639 X:134251621-134251643 ATTCATAGAGAGAGGTAGTGGGG - Intergenic
1198328894 X:135602982-135603004 CCTCATAAAATGAGTTAGGTAGG + Intergenic
1198337598 X:135682273-135682295 CCTCATAAAATGAGTTAGGTAGG - Intergenic
1198361543 X:135900498-135900520 TCTCATAAAATGAGTTAGGTAGG + Intronic
1198544393 X:137675728-137675750 CCTCATAAAAAGAGTTAGGGAGG - Intergenic
1198660053 X:138958530-138958552 CCTCATAAAAAGAGTTAGGGAGG + Intronic
1198785998 X:140288744-140288766 CTTCATAAAATGAGTTAGGGAGG + Intergenic
1198789955 X:140334204-140334226 CTTCATAAAATGAGTTAGGGAGG - Intergenic
1198888808 X:141369283-141369305 CTTCATAAAATGAGTTAGGGAGG - Intergenic
1198981695 X:142404909-142404931 CTTCATAAAATGAGTTAGGGAGG - Intergenic
1199023411 X:142909263-142909285 CCTCATAAAATGAGTTAGGTAGG + Intergenic
1199098020 X:143764808-143764830 CTTCATAAAATGAGTTAGGGAGG + Intergenic
1199842933 X:151668840-151668862 CCTCATAAAACGAGTTAGGTAGG - Intronic
1200290678 X:154870178-154870200 CTTCATAAAATGAGTTAGGGAGG - Intronic
1200352970 X:155518529-155518551 CTTCATAAAATGAGTTAGGGAGG + Intronic
1200387008 X:155902878-155902900 CTTCATAAAATGAGTTAGGGAGG + Intronic
1200956722 Y:8956492-8956514 CTTCATAAAATGAGTTAGGGAGG - Intergenic
1201052216 Y:9948588-9948610 ATTCGTAAAATGAAATAGGTAGG + Intergenic
1201231010 Y:11864245-11864267 CTTCATAAAATGAGTTAGGAAGG - Intergenic
1201238600 Y:11935820-11935842 CCTCATAAAAAGAGTTAGGGAGG - Intergenic
1201244633 Y:11991126-11991148 CCTCATAAAAAGAGTTAGGGAGG + Intergenic
1201394439 Y:13533345-13533367 CCTCATAAAATGAGGTAGGTAGG + Intergenic
1201520418 Y:14867235-14867257 ACTCATAAAATGAGTTAGGTAGG - Intergenic
1201561181 Y:15318804-15318826 ACTCATAAAATGAGTTAGGGAGG + Intergenic
1201705473 Y:16931978-16932000 CCTCATAAAATGAGGTAGGGAGG - Intergenic
1201775885 Y:17665197-17665219 CTTCATAAAATGAGTTAGGGAGG + Intergenic
1201825671 Y:18240795-18240817 CTTCATAAAATGAGTTAGGGAGG - Intergenic