ID: 1047022626

View in Genome Browser
Species Human (GRCh38)
Location 8:120792222-120792244
Sequence AGTTACTTCACTTAGAATAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 7230
Summary {0: 1012, 1: 1316, 2: 1081, 3: 1412, 4: 2409}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047022626_1047022630 19 Left 1047022626 8:120792222-120792244 CCATTATTCTAAGTGAAGTAACT 0: 1012
1: 1316
2: 1081
3: 1412
4: 2409
Right 1047022630 8:120792264-120792286 ACTGTATGTTCTCATAAGTGGGG No data
1047022626_1047022628 17 Left 1047022626 8:120792222-120792244 CCATTATTCTAAGTGAAGTAACT 0: 1012
1: 1316
2: 1081
3: 1412
4: 2409
Right 1047022628 8:120792262-120792284 ATACTGTATGTTCTCATAAGTGG No data
1047022626_1047022631 20 Left 1047022626 8:120792222-120792244 CCATTATTCTAAGTGAAGTAACT 0: 1012
1: 1316
2: 1081
3: 1412
4: 2409
Right 1047022631 8:120792265-120792287 CTGTATGTTCTCATAAGTGGGGG No data
1047022626_1047022629 18 Left 1047022626 8:120792222-120792244 CCATTATTCTAAGTGAAGTAACT 0: 1012
1: 1316
2: 1081
3: 1412
4: 2409
Right 1047022629 8:120792263-120792285 TACTGTATGTTCTCATAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047022626 Original CRISPR AGTTACTTCACTTAGAATAA TGG (reversed) Intronic
Too many off-targets to display for this crispr