ID: 1047022631

View in Genome Browser
Species Human (GRCh38)
Location 8:120792265-120792287
Sequence CTGTATGTTCTCATAAGTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047022626_1047022631 20 Left 1047022626 8:120792222-120792244 CCATTATTCTAAGTGAAGTAACT 0: 1012
1: 1316
2: 1081
3: 1412
4: 2409
Right 1047022631 8:120792265-120792287 CTGTATGTTCTCATAAGTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047022631 Original CRISPR CTGTATGTTCTCATAAGTGG GGG Intronic
No off target data available for this crispr