ID: 1047022631 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 8:120792265-120792287 |
| Sequence | CTGTATGTTCTCATAAGTGG GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1047022626_1047022631 | 20 | Left | 1047022626 | 8:120792222-120792244 | CCATTATTCTAAGTGAAGTAACT | 0: 1012 1: 1316 2: 1081 3: 1412 4: 2409 |
||
| Right | 1047022631 | 8:120792265-120792287 | CTGTATGTTCTCATAAGTGGGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1047022631 | Original CRISPR | CTGTATGTTCTCATAAGTGG GGG | Intronic | ||
| No off target data available for this crispr | |||||