ID: 1047025386

View in Genome Browser
Species Human (GRCh38)
Location 8:120817966-120817988
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047025386_1047025391 -4 Left 1047025386 8:120817966-120817988 CCCAAATACCACATCCTTATCCC No data
Right 1047025391 8:120817985-120818007 TCCCACTGCCTTCTCTGGCAAGG No data
1047025386_1047025397 21 Left 1047025386 8:120817966-120817988 CCCAAATACCACATCCTTATCCC No data
Right 1047025397 8:120818010-120818032 CTCAAGTTCTTCTACTGCTCTGG No data
1047025386_1047025393 -3 Left 1047025386 8:120817966-120817988 CCCAAATACCACATCCTTATCCC No data
Right 1047025393 8:120817986-120818008 CCCACTGCCTTCTCTGGCAAGGG No data
1047025386_1047025398 22 Left 1047025386 8:120817966-120817988 CCCAAATACCACATCCTTATCCC No data
Right 1047025398 8:120818011-120818033 TCAAGTTCTTCTACTGCTCTGGG No data
1047025386_1047025390 -9 Left 1047025386 8:120817966-120817988 CCCAAATACCACATCCTTATCCC No data
Right 1047025390 8:120817980-120818002 CCTTATCCCACTGCCTTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047025386 Original CRISPR GGGATAAGGATGTGGTATTT GGG (reversed) Intergenic