ID: 1047025391

View in Genome Browser
Species Human (GRCh38)
Location 8:120817985-120818007
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047025386_1047025391 -4 Left 1047025386 8:120817966-120817988 CCCAAATACCACATCCTTATCCC No data
Right 1047025391 8:120817985-120818007 TCCCACTGCCTTCTCTGGCAAGG No data
1047025387_1047025391 -5 Left 1047025387 8:120817967-120817989 CCAAATACCACATCCTTATCCCA No data
Right 1047025391 8:120817985-120818007 TCCCACTGCCTTCTCTGGCAAGG No data
1047025385_1047025391 -3 Left 1047025385 8:120817965-120817987 CCCCAAATACCACATCCTTATCC No data
Right 1047025391 8:120817985-120818007 TCCCACTGCCTTCTCTGGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047025391 Original CRISPR TCCCACTGCCTTCTCTGGCA AGG Intergenic
No off target data available for this crispr