ID: 1047030403

View in Genome Browser
Species Human (GRCh38)
Location 8:120872927-120872949
Sequence CACACCTAATAAGCCAATGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047030403_1047030405 17 Left 1047030403 8:120872927-120872949 CCACCATTGGCTTATTAGGTGTG No data
Right 1047030405 8:120872967-120872989 TTATTAGTATTCTTATTAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047030403 Original CRISPR CACACCTAATAAGCCAATGG TGG (reversed) Intergenic
No off target data available for this crispr