ID: 1047030405

View in Genome Browser
Species Human (GRCh38)
Location 8:120872967-120872989
Sequence TTATTAGTATTCTTATTAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047030404_1047030405 14 Left 1047030404 8:120872930-120872952 CCATTGGCTTATTAGGTGTGCTC No data
Right 1047030405 8:120872967-120872989 TTATTAGTATTCTTATTAGTAGG No data
1047030403_1047030405 17 Left 1047030403 8:120872927-120872949 CCACCATTGGCTTATTAGGTGTG No data
Right 1047030405 8:120872967-120872989 TTATTAGTATTCTTATTAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047030405 Original CRISPR TTATTAGTATTCTTATTAGT AGG Intergenic
No off target data available for this crispr