ID: 1047030921

View in Genome Browser
Species Human (GRCh38)
Location 8:120879833-120879855
Sequence CAGTGGACCTGGAGAGAAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047030914_1047030921 16 Left 1047030914 8:120879794-120879816 CCTGGCAAGAGGTGATAGTGGCC No data
Right 1047030921 8:120879833-120879855 CAGTGGACCTGGAGAGAAGTTGG No data
1047030918_1047030921 -5 Left 1047030918 8:120879815-120879837 CCTGGAGTAGGGTAGTGTCAGTG No data
Right 1047030921 8:120879833-120879855 CAGTGGACCTGGAGAGAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047030921 Original CRISPR CAGTGGACCTGGAGAGAAGT TGG Intergenic
No off target data available for this crispr