ID: 1047033017

View in Genome Browser
Species Human (GRCh38)
Location 8:120904117-120904139
Sequence GAGTATACACAGATGAATAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047033015_1047033017 -2 Left 1047033015 8:120904096-120904118 CCAGGTTTTATGTTAACTGCTGA No data
Right 1047033017 8:120904117-120904139 GAGTATACACAGATGAATAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047033017 Original CRISPR GAGTATACACAGATGAATAA GGG Intergenic
No off target data available for this crispr