ID: 1047034700

View in Genome Browser
Species Human (GRCh38)
Location 8:120924465-120924487
Sequence TTACATATGAGACTTGTGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047034698_1047034700 6 Left 1047034698 8:120924436-120924458 CCCTAGTTAACAGCATGATTTGA No data
Right 1047034700 8:120924465-120924487 TTACATATGAGACTTGTGTTTGG No data
1047034699_1047034700 5 Left 1047034699 8:120924437-120924459 CCTAGTTAACAGCATGATTTGAT No data
Right 1047034700 8:120924465-120924487 TTACATATGAGACTTGTGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047034700 Original CRISPR TTACATATGAGACTTGTGTT TGG Intergenic
No off target data available for this crispr