ID: 1047036951

View in Genome Browser
Species Human (GRCh38)
Location 8:120950601-120950623
Sequence CACTTAAACCCGGGAGGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047036951_1047036960 17 Left 1047036951 8:120950601-120950623 CCTCCTCCTCCCGGGTTTAAGTG No data
Right 1047036960 8:120950641-120950663 TCCCGAGTAGCTGGGATTACAGG 0: 44204
1: 206428
2: 253404
3: 185491
4: 423321
1047036951_1047036959 9 Left 1047036951 8:120950601-120950623 CCTCCTCCTCCCGGGTTTAAGTG No data
Right 1047036959 8:120950633-120950655 CCTCTGTCTCCCGAGTAGCTGGG 0: 35
1: 4124
2: 117771
3: 302496
4: 222735
1047036951_1047036957 8 Left 1047036951 8:120950601-120950623 CCTCCTCCTCCCGGGTTTAAGTG No data
Right 1047036957 8:120950632-120950654 GCCTCTGTCTCCCGAGTAGCTGG 0: 28
1: 3685
2: 110189
3: 273755
4: 218047

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047036951 Original CRISPR CACTTAAACCCGGGAGGAGG AGG (reversed) Intergenic
No off target data available for this crispr