ID: 1047036953

View in Genome Browser
Species Human (GRCh38)
Location 8:120950607-120950629
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047036953_1047036963 30 Left 1047036953 8:120950607-120950629 CCTCCCGGGTTTAAGTGATTCTC No data
Right 1047036963 8:120950660-120950682 CAGGCACGTGCCACCATGCCCGG No data
1047036953_1047036957 2 Left 1047036953 8:120950607-120950629 CCTCCCGGGTTTAAGTGATTCTC No data
Right 1047036957 8:120950632-120950654 GCCTCTGTCTCCCGAGTAGCTGG No data
1047036953_1047036960 11 Left 1047036953 8:120950607-120950629 CCTCCCGGGTTTAAGTGATTCTC No data
Right 1047036960 8:120950641-120950663 TCCCGAGTAGCTGGGATTACAGG 0: 44204
1: 206428
2: 253404
3: 185491
4: 423321
1047036953_1047036959 3 Left 1047036953 8:120950607-120950629 CCTCCCGGGTTTAAGTGATTCTC No data
Right 1047036959 8:120950633-120950655 CCTCTGTCTCCCGAGTAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047036953 Original CRISPR GAGAATCACTTAAACCCGGG AGG (reversed) Intergenic