ID: 1047036955

View in Genome Browser
Species Human (GRCh38)
Location 8:120950611-120950633
Sequence GCAGGAGAATCACTTAAACC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047036955_1047036963 26 Left 1047036955 8:120950611-120950633 CCGGGTTTAAGTGATTCTCCTGC No data
Right 1047036963 8:120950660-120950682 CAGGCACGTGCCACCATGCCCGG No data
1047036955_1047036957 -2 Left 1047036955 8:120950611-120950633 CCGGGTTTAAGTGATTCTCCTGC No data
Right 1047036957 8:120950632-120950654 GCCTCTGTCTCCCGAGTAGCTGG No data
1047036955_1047036960 7 Left 1047036955 8:120950611-120950633 CCGGGTTTAAGTGATTCTCCTGC No data
Right 1047036960 8:120950641-120950663 TCCCGAGTAGCTGGGATTACAGG 0: 44204
1: 206428
2: 253404
3: 185491
4: 423321
1047036955_1047036959 -1 Left 1047036955 8:120950611-120950633 CCGGGTTTAAGTGATTCTCCTGC No data
Right 1047036959 8:120950633-120950655 CCTCTGTCTCCCGAGTAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047036955 Original CRISPR GCAGGAGAATCACTTAAACC CGG (reversed) Intergenic