ID: 1047036957

View in Genome Browser
Species Human (GRCh38)
Location 8:120950632-120950654
Sequence GCCTCTGTCTCCCGAGTAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 605704
Summary {0: 28, 1: 3685, 2: 110189, 3: 273755, 4: 218047}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047036954_1047036957 -1 Left 1047036954 8:120950610-120950632 CCCGGGTTTAAGTGATTCTCCTG 0: 787
1: 37445
2: 106798
3: 158714
4: 202289
Right 1047036957 8:120950632-120950654 GCCTCTGTCTCCCGAGTAGCTGG 0: 28
1: 3685
2: 110189
3: 273755
4: 218047
1047036953_1047036957 2 Left 1047036953 8:120950607-120950629 CCTCCCGGGTTTAAGTGATTCTC 0: 327
1: 16658
2: 83506
3: 146673
4: 189483
Right 1047036957 8:120950632-120950654 GCCTCTGTCTCCCGAGTAGCTGG 0: 28
1: 3685
2: 110189
3: 273755
4: 218047
1047036952_1047036957 5 Left 1047036952 8:120950604-120950626 CCTCCTCCCGGGTTTAAGTGATT 0: 220
1: 10842
2: 53890
3: 92426
4: 122603
Right 1047036957 8:120950632-120950654 GCCTCTGTCTCCCGAGTAGCTGG 0: 28
1: 3685
2: 110189
3: 273755
4: 218047
1047036951_1047036957 8 Left 1047036951 8:120950601-120950623 CCTCCTCCTCCCGGGTTTAAGTG No data
Right 1047036957 8:120950632-120950654 GCCTCTGTCTCCCGAGTAGCTGG 0: 28
1: 3685
2: 110189
3: 273755
4: 218047
1047036955_1047036957 -2 Left 1047036955 8:120950611-120950633 CCGGGTTTAAGTGATTCTCCTGC 0: 818
1: 36531
2: 84887
3: 103369
4: 124229
Right 1047036957 8:120950632-120950654 GCCTCTGTCTCCCGAGTAGCTGG 0: 28
1: 3685
2: 110189
3: 273755
4: 218047

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047036957 Original CRISPR GCCTCTGTCTCCCGAGTAGC TGG Intergenic
Too many off-targets to display for this crispr