ID: 1047036957

View in Genome Browser
Species Human (GRCh38)
Location 8:120950632-120950654
Sequence GCCTCTGTCTCCCGAGTAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047036952_1047036957 5 Left 1047036952 8:120950604-120950626 CCTCCTCCCGGGTTTAAGTGATT No data
Right 1047036957 8:120950632-120950654 GCCTCTGTCTCCCGAGTAGCTGG No data
1047036953_1047036957 2 Left 1047036953 8:120950607-120950629 CCTCCCGGGTTTAAGTGATTCTC No data
Right 1047036957 8:120950632-120950654 GCCTCTGTCTCCCGAGTAGCTGG No data
1047036954_1047036957 -1 Left 1047036954 8:120950610-120950632 CCCGGGTTTAAGTGATTCTCCTG No data
Right 1047036957 8:120950632-120950654 GCCTCTGTCTCCCGAGTAGCTGG No data
1047036951_1047036957 8 Left 1047036951 8:120950601-120950623 CCTCCTCCTCCCGGGTTTAAGTG No data
Right 1047036957 8:120950632-120950654 GCCTCTGTCTCCCGAGTAGCTGG No data
1047036955_1047036957 -2 Left 1047036955 8:120950611-120950633 CCGGGTTTAAGTGATTCTCCTGC No data
Right 1047036957 8:120950632-120950654 GCCTCTGTCTCCCGAGTAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047036957 Original CRISPR GCCTCTGTCTCCCGAGTAGC TGG Intergenic