ID: 1047036959

View in Genome Browser
Species Human (GRCh38)
Location 8:120950633-120950655
Sequence CCTCTGTCTCCCGAGTAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047036953_1047036959 3 Left 1047036953 8:120950607-120950629 CCTCCCGGGTTTAAGTGATTCTC No data
Right 1047036959 8:120950633-120950655 CCTCTGTCTCCCGAGTAGCTGGG No data
1047036952_1047036959 6 Left 1047036952 8:120950604-120950626 CCTCCTCCCGGGTTTAAGTGATT No data
Right 1047036959 8:120950633-120950655 CCTCTGTCTCCCGAGTAGCTGGG No data
1047036951_1047036959 9 Left 1047036951 8:120950601-120950623 CCTCCTCCTCCCGGGTTTAAGTG No data
Right 1047036959 8:120950633-120950655 CCTCTGTCTCCCGAGTAGCTGGG No data
1047036955_1047036959 -1 Left 1047036955 8:120950611-120950633 CCGGGTTTAAGTGATTCTCCTGC No data
Right 1047036959 8:120950633-120950655 CCTCTGTCTCCCGAGTAGCTGGG No data
1047036954_1047036959 0 Left 1047036954 8:120950610-120950632 CCCGGGTTTAAGTGATTCTCCTG No data
Right 1047036959 8:120950633-120950655 CCTCTGTCTCCCGAGTAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047036959 Original CRISPR CCTCTGTCTCCCGAGTAGCT GGG Intergenic