ID: 1047036960

View in Genome Browser
Species Human (GRCh38)
Location 8:120950641-120950663
Sequence TCCCGAGTAGCTGGGATTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1112848
Summary {0: 44204, 1: 206428, 2: 253404, 3: 185491, 4: 423321}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047036953_1047036960 11 Left 1047036953 8:120950607-120950629 CCTCCCGGGTTTAAGTGATTCTC No data
Right 1047036960 8:120950641-120950663 TCCCGAGTAGCTGGGATTACAGG 0: 44204
1: 206428
2: 253404
3: 185491
4: 423321
1047036952_1047036960 14 Left 1047036952 8:120950604-120950626 CCTCCTCCCGGGTTTAAGTGATT No data
Right 1047036960 8:120950641-120950663 TCCCGAGTAGCTGGGATTACAGG 0: 44204
1: 206428
2: 253404
3: 185491
4: 423321
1047036954_1047036960 8 Left 1047036954 8:120950610-120950632 CCCGGGTTTAAGTGATTCTCCTG No data
Right 1047036960 8:120950641-120950663 TCCCGAGTAGCTGGGATTACAGG 0: 44204
1: 206428
2: 253404
3: 185491
4: 423321
1047036955_1047036960 7 Left 1047036955 8:120950611-120950633 CCGGGTTTAAGTGATTCTCCTGC No data
Right 1047036960 8:120950641-120950663 TCCCGAGTAGCTGGGATTACAGG 0: 44204
1: 206428
2: 253404
3: 185491
4: 423321
1047036951_1047036960 17 Left 1047036951 8:120950601-120950623 CCTCCTCCTCCCGGGTTTAAGTG No data
Right 1047036960 8:120950641-120950663 TCCCGAGTAGCTGGGATTACAGG 0: 44204
1: 206428
2: 253404
3: 185491
4: 423321

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047036960 Original CRISPR TCCCGAGTAGCTGGGATTAC AGG Intergenic