ID: 1047036963

View in Genome Browser
Species Human (GRCh38)
Location 8:120950660-120950682
Sequence CAGGCACGTGCCACCATGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047036958_1047036963 4 Left 1047036958 8:120950633-120950655 CCTCTGTCTCCCGAGTAGCTGGG No data
Right 1047036963 8:120950660-120950682 CAGGCACGTGCCACCATGCCCGG No data
1047036961_1047036963 -5 Left 1047036961 8:120950642-120950664 CCCGAGTAGCTGGGATTACAGGC No data
Right 1047036963 8:120950660-120950682 CAGGCACGTGCCACCATGCCCGG No data
1047036955_1047036963 26 Left 1047036955 8:120950611-120950633 CCGGGTTTAAGTGATTCTCCTGC No data
Right 1047036963 8:120950660-120950682 CAGGCACGTGCCACCATGCCCGG No data
1047036956_1047036963 8 Left 1047036956 8:120950629-120950651 CCTGCCTCTGTCTCCCGAGTAGC No data
Right 1047036963 8:120950660-120950682 CAGGCACGTGCCACCATGCCCGG No data
1047036954_1047036963 27 Left 1047036954 8:120950610-120950632 CCCGGGTTTAAGTGATTCTCCTG No data
Right 1047036963 8:120950660-120950682 CAGGCACGTGCCACCATGCCCGG No data
1047036953_1047036963 30 Left 1047036953 8:120950607-120950629 CCTCCCGGGTTTAAGTGATTCTC No data
Right 1047036963 8:120950660-120950682 CAGGCACGTGCCACCATGCCCGG No data
1047036962_1047036963 -6 Left 1047036962 8:120950643-120950665 CCGAGTAGCTGGGATTACAGGCA No data
Right 1047036963 8:120950660-120950682 CAGGCACGTGCCACCATGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047036963 Original CRISPR CAGGCACGTGCCACCATGCC CGG Intergenic