ID: 1047040121

View in Genome Browser
Species Human (GRCh38)
Location 8:120984263-120984285
Sequence GAACTCAGCTGGTCTGTTAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047040121_1047040124 3 Left 1047040121 8:120984263-120984285 CCCGTAACAGACCAGCTGAGTTC No data
Right 1047040124 8:120984289-120984311 TCTCAAATCCACTGCCGACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047040121 Original CRISPR GAACTCAGCTGGTCTGTTAC GGG (reversed) Intergenic
No off target data available for this crispr