ID: 1047042215

View in Genome Browser
Species Human (GRCh38)
Location 8:121008545-121008567
Sequence CTTTCCAGGGATCAGTTTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047042215_1047042219 10 Left 1047042215 8:121008545-121008567 CCACAAAACTGATCCCTGGAAAG No data
Right 1047042219 8:121008578-121008600 CTGTATAGCACTTCTTTAGAGGG No data
1047042215_1047042218 9 Left 1047042215 8:121008545-121008567 CCACAAAACTGATCCCTGGAAAG No data
Right 1047042218 8:121008577-121008599 TCTGTATAGCACTTCTTTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047042215 Original CRISPR CTTTCCAGGGATCAGTTTTG TGG (reversed) Intergenic
No off target data available for this crispr