ID: 1047054313

View in Genome Browser
Species Human (GRCh38)
Location 8:121147175-121147197
Sequence TTAGGTAAACTGAAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047054313_1047054319 -7 Left 1047054313 8:121147175-121147197 CCTTCCTCCTTCAGTTTACCTAA No data
Right 1047054319 8:121147191-121147213 TACCTAAAAGGATGGGAAGCTGG No data
1047054313_1047054322 -2 Left 1047054313 8:121147175-121147197 CCTTCCTCCTTCAGTTTACCTAA No data
Right 1047054322 8:121147196-121147218 AAAAGGATGGGAAGCTGGGAAGG No data
1047054313_1047054320 -6 Left 1047054313 8:121147175-121147197 CCTTCCTCCTTCAGTTTACCTAA No data
Right 1047054320 8:121147192-121147214 ACCTAAAAGGATGGGAAGCTGGG No data
1047054313_1047054323 -1 Left 1047054313 8:121147175-121147197 CCTTCCTCCTTCAGTTTACCTAA No data
Right 1047054323 8:121147197-121147219 AAAGGATGGGAAGCTGGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047054313 Original CRISPR TTAGGTAAACTGAAGGAGGA AGG (reversed) Intergenic
No off target data available for this crispr