ID: 1047054749

View in Genome Browser
Species Human (GRCh38)
Location 8:121151651-121151673
Sequence GAGAATAAACGGTTGTTCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047054749_1047054752 -8 Left 1047054749 8:121151651-121151673 CCTTAGAACAACCGTTTATTCTC No data
Right 1047054752 8:121151666-121151688 TTATTCTCTCACAGTTCTGGAGG 0: 186
1: 1250
2: 3238
3: 6353
4: 10745
1047054749_1047054753 12 Left 1047054749 8:121151651-121151673 CCTTAGAACAACCGTTTATTCTC No data
Right 1047054753 8:121151686-121151708 AGGCCAGAAATCTGAAACCACGG No data
1047054749_1047054755 22 Left 1047054749 8:121151651-121151673 CCTTAGAACAACCGTTTATTCTC No data
Right 1047054755 8:121151696-121151718 TCTGAAACCACGGTGTTAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047054749 Original CRISPR GAGAATAAACGGTTGTTCTA AGG (reversed) Intergenic
No off target data available for this crispr