ID: 1047056760

View in Genome Browser
Species Human (GRCh38)
Location 8:121173718-121173740
Sequence CATGAGAGGGAACCCGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047056760_1047056774 25 Left 1047056760 8:121173718-121173740 CCTCCCACGGGTTCCCTCTCATG No data
Right 1047056774 8:121173766-121173788 ATTCAAGGTGAGATTTGGGTGGG 0: 1285
1: 9579
2: 10700
3: 9355
4: 7118
1047056760_1047056769 10 Left 1047056760 8:121173718-121173740 CCTCCCACGGGTTCCCTCTCATG No data
Right 1047056769 8:121173751-121173773 ATTATGGGAGCCACAATTCAAGG No data
1047056760_1047056775 26 Left 1047056760 8:121173718-121173740 CCTCCCACGGGTTCCCTCTCATG No data
Right 1047056775 8:121173767-121173789 TTCAAGGTGAGATTTGGGTGGGG 0: 1231
1: 9508
2: 11048
3: 8658
4: 6483
1047056760_1047056771 20 Left 1047056760 8:121173718-121173740 CCTCCCACGGGTTCCCTCTCATG No data
Right 1047056771 8:121173761-121173783 CCACAATTCAAGGTGAGATTTGG No data
1047056760_1047056772 21 Left 1047056760 8:121173718-121173740 CCTCCCACGGGTTCCCTCTCATG No data
Right 1047056772 8:121173762-121173784 CACAATTCAAGGTGAGATTTGGG 0: 23
1: 1542
2: 9446
3: 10484
4: 9686
1047056760_1047056768 -5 Left 1047056760 8:121173718-121173740 CCTCCCACGGGTTCCCTCTCATG No data
Right 1047056768 8:121173736-121173758 TCATGACACATGGGAATTATGGG 0: 23
1: 283
2: 1217
3: 2995
4: 5011
1047056760_1047056767 -6 Left 1047056760 8:121173718-121173740 CCTCCCACGGGTTCCCTCTCATG No data
Right 1047056767 8:121173735-121173757 CTCATGACACATGGGAATTATGG No data
1047056760_1047056773 24 Left 1047056760 8:121173718-121173740 CCTCCCACGGGTTCCCTCTCATG No data
Right 1047056773 8:121173765-121173787 AATTCAAGGTGAGATTTGGGTGG 0: 1258
1: 9618
2: 11033
3: 8774
4: 7969

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047056760 Original CRISPR CATGAGAGGGAACCCGTGGG AGG (reversed) Intergenic
No off target data available for this crispr