ID: 1047058294

View in Genome Browser
Species Human (GRCh38)
Location 8:121192862-121192884
Sequence ACTACTATGTAGAAGAGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047058291_1047058294 19 Left 1047058291 8:121192820-121192842 CCAAAACTCAATGGGATTAGGTG No data
Right 1047058294 8:121192862-121192884 ACTACTATGTAGAAGAGTGAAGG No data
1047058293_1047058294 -8 Left 1047058293 8:121192847-121192869 CCTCAAAGTTGTAGAACTACTAT No data
Right 1047058294 8:121192862-121192884 ACTACTATGTAGAAGAGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047058294 Original CRISPR ACTACTATGTAGAAGAGTGA AGG Intergenic
No off target data available for this crispr