ID: 1047058975

View in Genome Browser
Species Human (GRCh38)
Location 8:121200146-121200168
Sequence AGATGTCTGCTGCTGTTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047058975_1047058980 25 Left 1047058975 8:121200146-121200168 CCTGCCAACAGCAGCAGACATCT No data
Right 1047058980 8:121200194-121200216 CCCTCTGTAAATTGCCTGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047058975 Original CRISPR AGATGTCTGCTGCTGTTGGC AGG (reversed) Intergenic
No off target data available for this crispr