ID: 1047061430

View in Genome Browser
Species Human (GRCh38)
Location 8:121231214-121231236
Sequence ATGAACAATGTGAAGGTAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047061427_1047061430 -6 Left 1047061427 8:121231197-121231219 CCTCTGCAAAGCAGATTATGAAC No data
Right 1047061430 8:121231214-121231236 ATGAACAATGTGAAGGTAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047061430 Original CRISPR ATGAACAATGTGAAGGTAGA GGG Intergenic
No off target data available for this crispr